ID: 947915839

View in Genome Browser
Species Human (GRCh38)
Location 2:233831118-233831140
Sequence CCCATGGAGGGCTGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947915824_947915839 16 Left 947915824 2:233831079-233831101 CCCAGTCTTGCCTGCTCAAGCCC 0: 1
1: 0
2: 0
3: 12
4: 186
Right 947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG 0: 1
1: 0
2: 4
3: 54
4: 333
947915825_947915839 15 Left 947915825 2:233831080-233831102 CCAGTCTTGCCTGCTCAAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG 0: 1
1: 0
2: 4
3: 54
4: 333
947915828_947915839 -4 Left 947915828 2:233831099-233831121 CCCGGCTCCCGCCTCTGATCCCA 0: 1
1: 0
2: 6
3: 223
4: 1000
Right 947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG 0: 1
1: 0
2: 4
3: 54
4: 333
947915827_947915839 6 Left 947915827 2:233831089-233831111 CCTGCTCAAGCCCGGCTCCCGCC 0: 1
1: 0
2: 2
3: 29
4: 435
Right 947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG 0: 1
1: 0
2: 4
3: 54
4: 333
947915829_947915839 -5 Left 947915829 2:233831100-233831122 CCGGCTCCCGCCTCTGATCCCAT 0: 1
1: 0
2: 2
3: 21
4: 336
Right 947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG 0: 1
1: 0
2: 4
3: 54
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947915839 Original CRISPR CCCATGGAGGGCTGGGTCCC AGG Intronic
900104207 1:975412-975434 CAGATGGAGGGCTGGGCTCCTGG - Exonic
900173650 1:1282390-1282412 CCCAAGTGGTGCTGGGTCCCTGG - Intronic
900420200 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG + Intergenic
900424231 1:2568682-2568704 CCCTTGGAGGGCTGGAACCCAGG - Intergenic
900474617 1:2870281-2870303 CCCAGGGAGGGCTGGCCCCGGGG - Intergenic
900532245 1:3160329-3160351 CACCTGGTGTGCTGGGTCCCTGG + Intronic
901811453 1:11769027-11769049 CTCCTGGAGGGCGGGGACCCTGG - Intronic
902509085 1:16955836-16955858 GCCCTGCAGGGCTGGGGCCCAGG - Intronic
902555898 1:17246379-17246401 CCCCAGCAGGGCTGGTTCCCAGG + Intergenic
902908581 1:19578204-19578226 TCCATGGATGCCTGGGTCTCTGG - Intergenic
903261264 1:22132879-22132901 CCCGGGCAGGGCTGGGTGCCAGG + Intronic
903277904 1:22233288-22233310 CCAATGGAGGCCTGGATCCTGGG + Intergenic
903944343 1:26952219-26952241 CCCATGGTGGCCAGGGTCCTTGG + Exonic
904500775 1:30911628-30911650 CCCAGGGAGACCTGGGACCCGGG - Intergenic
904872172 1:33625655-33625677 GTCATGGAGGGCAGGGCCCCAGG - Intronic
905272377 1:36795425-36795447 CCCAGGGATGACTGTGTCCCAGG - Intergenic
907409663 1:54275108-54275130 CCCCTTGAGGGCAGGGTCCGTGG + Intronic
911232341 1:95374369-95374391 CCAATAGATGGCTGGGGCCCGGG + Intergenic
912453459 1:109782704-109782726 ACCCTGGAGGCCTGGGGCCCTGG + Intergenic
913578126 1:120197408-120197430 CGCGCGGAGGGCTGGGGCCCGGG + Intergenic
913630045 1:120700944-120700966 CGCGCGGAGGGCTGGGGCCCCGG - Intergenic
913971578 1:143421542-143421564 TCCATGCAGAGCTGGGCCCCTGG + Intergenic
913983482 1:143544553-143544575 CCCATGGAGGCCAGGGTGACAGG - Intergenic
914065955 1:144247155-144247177 TCCATGCAGAGCTGGGCCCCTGG + Intergenic
914113196 1:144719199-144719221 TCCATGCAGAGCTGGGCCCCTGG - Intergenic
914560043 1:148808828-148808850 CGCGCGGAGGGCTGGGGCCCCGG + Intronic
914612790 1:149321387-149321409 CGCGCGGAGGGCTGGGGCCCCGG - Intergenic
914847778 1:151292362-151292384 CCCTGGGAGGGGTAGGTCCCTGG + Exonic
914911561 1:151791273-151791295 CCCAGGGAAGGGTGGGCCCCTGG - Exonic
916746781 1:167690918-167690940 CCCAGGGCTGGCTGGCTCCCTGG + Intronic
918462990 1:184795314-184795336 CCCATGGAGGGGGAGCTCCCAGG - Exonic
920690853 1:208145338-208145360 CAGCTGCAGGGCTGGGTCCCAGG + Intronic
920983528 1:210862224-210862246 CTCTTGCAGGGCTGGGTCCATGG + Intronic
922756571 1:228100263-228100285 CCCAGGGAGGGCTGAGGCCCTGG - Intergenic
1062824288 10:557004-557026 ACCATCGAGGGCTGGCTCCTGGG - Intronic
1063473324 10:6306708-6306730 CCCATGGAAGGCCGTGTCCTGGG + Intergenic
1064643064 10:17433888-17433910 CCTCGGGATGGCTGGGTCCCAGG - Intronic
1067084267 10:43229773-43229795 CCGCTGGAGGGGTGGGACCCCGG + Intronic
1068121330 10:52784838-52784860 CCCATGCAGGTCTGGTGCCCTGG + Intergenic
1068596178 10:58905219-58905241 CCCATGGGGAGCTCTGTCCCAGG - Intergenic
1069883852 10:71611064-71611086 CCCATGGGGGGCTGGGGGGCTGG - Intronic
1072551281 10:96479550-96479572 CCCTTGGGGTGCTGGGTTCCTGG - Intronic
1074147999 10:110733537-110733559 CCCATGCAGGGCTAGCTCCTTGG + Intronic
1074766471 10:116703751-116703773 CCCATGGATGGGTGGCACCCGGG + Intronic
1074776120 10:116769464-116769486 CACCTTGAGGGCTGGGGCCCGGG + Intergenic
1075990701 10:126836369-126836391 CCCATAGAGGGCAGGGGTCCTGG + Intergenic
1076096158 10:127736526-127736548 CCCACGGAGGGTCGGGACCCTGG - Intergenic
1076310150 10:129500313-129500335 GCCATGGGGGGCTGCCTCCCAGG + Intronic
1076499417 10:130924550-130924572 CCCACGGAGGGCTGGGTGCTGGG - Intergenic
1076540904 10:131214174-131214196 CCCAGGGAGGGGTGGGAGCCTGG + Intronic
1076547884 10:131258084-131258106 CCCATGGAGGGGTGGGTAGAGGG - Intronic
1076558061 10:131342925-131342947 CCCATGGAGTCCTGGCACCCAGG - Intergenic
1076744995 10:132508413-132508435 CTGGTGGAGAGCTGGGTCCCTGG - Intergenic
1076802418 10:132836697-132836719 CCCAGGGAGGCCTGGGACTCGGG - Intronic
1077373353 11:2193868-2193890 CCCATGGAGGGCAGGCCCCTGGG + Intergenic
1077602310 11:3582077-3582099 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1077798263 11:5513697-5513719 CCCATGGAGGGCTGGATTTGTGG + Intronic
1079087560 11:17457651-17457673 CCCAGGGAAAGCTGGGACCCAGG - Intronic
1080737069 11:35026625-35026647 CCCATGGAGGTCTGTGCCTCAGG - Intergenic
1081526815 11:43933326-43933348 CCCTGGGAGGGCTGGTTCTCTGG - Intronic
1081665354 11:44913865-44913887 CCCAGGAATGGCTGGGTCCAGGG + Intronic
1082788670 11:57332116-57332138 CCCAGGCAGGGCAGGATCCCAGG + Intronic
1083667574 11:64284284-64284306 CCCCTGCGGGGCTGGGGCCCAGG + Exonic
1083696820 11:64448899-64448921 CCCAGGGAGGGCCGGGGCCCAGG - Intergenic
1083799142 11:65036163-65036185 CCAATGGAGGTCAGGGTCCTGGG + Intronic
1083994528 11:66265581-66265603 CCCACTGTGGGCTGGGTGCCAGG + Intronic
1084192646 11:67505789-67505811 ACCATAGAGGCCTGGGGCCCTGG - Intronic
1084258203 11:67956628-67956650 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1084523900 11:69684217-69684239 CCATGGCAGGGCTGGGTCCCCGG - Intergenic
1084778971 11:71396434-71396456 CCCAGGGAGGGCTGTCGCCCAGG - Intergenic
1084804852 11:71571653-71571675 GCCATGGGGGGCTGGGGGCCGGG + Intergenic
1084814541 11:71638586-71638608 TCCCTGCACGGCTGGGTCCCAGG + Intergenic
1085448244 11:76615435-76615457 CTCATGGAGGGCTGGGCCCCGGG - Intergenic
1088823366 11:113474923-113474945 CCCATGCAGAGCCGGATCCCAGG + Intronic
1089148801 11:116349014-116349036 ACCAGGGAAGGCTGGGTCCAAGG + Intergenic
1089391758 11:118107005-118107027 TCCATGGAGGGCTGAGTCATTGG - Intronic
1089662035 11:119992090-119992112 CCCAGGCAGGGCTCAGTCCCGGG - Intergenic
1090780316 11:130001999-130002021 GCCATCGATGGCTGGGCCCCCGG - Intronic
1091023808 11:132124273-132124295 CTCAGGGAGGGCAGGGCCCCAGG - Intronic
1092428451 12:8391429-8391451 CCCCTGCACGGCTGGGTCCAAGG - Intergenic
1092429534 12:8397581-8397603 CCCCTGCACGGCTGGGTCCAAGG - Intergenic
1095259694 12:40083729-40083751 CCTTTGGAGGGGTGAGTCCCAGG - Intronic
1095970983 12:47901897-47901919 CGAGTGGTGGGCTGGGTCCCAGG + Intronic
1096464392 12:51840282-51840304 CCCATGCAGGGCCAAGTCCCAGG - Intergenic
1097033202 12:56104424-56104446 CCCTTGGAGGGCAAGGCCCCAGG + Exonic
1100455883 12:94751307-94751329 GCCATGGAGGGATGGGTCTTGGG + Intergenic
1103443849 12:120981295-120981317 CCCAGGGAGGCCTGGGACCCAGG - Intronic
1103983992 12:124755137-124755159 CCCAGGCAGGGCTGGGCCTCGGG - Intergenic
1104191790 12:126488861-126488883 CCCATGGAGGGCAGTGTTGCAGG + Intergenic
1104838669 12:131809184-131809206 GGCAGGGAGGGCTGGGGCCCCGG + Intergenic
1104929027 12:132328751-132328773 CCACTGGAGGGGTGGGTGCCCGG + Intronic
1105610950 13:21969502-21969524 CCCATGGAGGGTTGTGGCCCCGG + Intergenic
1106915707 13:34511606-34511628 CCAATGGAGAGCTGGGGACCTGG + Intergenic
1107717948 13:43219147-43219169 CACATGGAGCCCTGGGTTCCTGG + Intronic
1108112607 13:47092227-47092249 CCCATGGAGGATTGGGGCCTGGG - Intergenic
1111187581 13:84759627-84759649 CCCATGGATGGCTGAAACCCTGG - Intergenic
1111292698 13:86188440-86188462 TGCATGGAGGGCATGGTCCCTGG + Intergenic
1114227996 14:20756161-20756183 CCCCTCCAGGGCTAGGTCCCTGG - Intergenic
1114418116 14:22557416-22557438 CCCAGGGAGGGCTGGGGGCCCGG + Intronic
1114720050 14:24871948-24871970 GCCATGGAGGTCTGGGCCCATGG - Intronic
1115645729 14:35367399-35367421 GCCCTGGTGGGCTGGGTTCCAGG - Intergenic
1115645889 14:35368200-35368222 CCAATGGAGTGCAGGGGCCCGGG - Intergenic
1118787239 14:69056075-69056097 ACCATGGAGGGCTGAGTGCTGGG - Intronic
1118972364 14:70647873-70647895 CCCATTGAGGGCTGGCTTCAAGG - Intronic
1119134275 14:72202719-72202741 CCCTTGGAGGGGAGGGTCCTGGG + Intronic
1119264535 14:73256128-73256150 TCCATGGAGAGCTGGACCCCTGG - Intronic
1119981939 14:79091552-79091574 CCCATGGGGCGCTTTGTCCCAGG + Intronic
1120893602 14:89510397-89510419 CATATGCAGGGCTGGCTCCCTGG - Intronic
1121926068 14:97928473-97928495 CCCATGGAGGGCTGCCTCACTGG - Intronic
1122080251 14:99262209-99262231 GCCAGGGAGGGCGGGGTCCTTGG - Intronic
1122405626 14:101499115-101499137 CCCAGGGAGGCCTCGCTCCCAGG + Intergenic
1122971993 14:105156113-105156135 CACACGGAGGGCAGGGCCCCCGG + Intronic
1202904521 14_GL000194v1_random:60511-60533 CCCATGCAGGGCAGGATGCCAGG + Intergenic
1127978412 15:64016089-64016111 CGCAGGGAGGGCTGGCTCCAGGG + Intronic
1128222358 15:65978267-65978289 CCCAGGGAGAGCTGGGACCAAGG - Intronic
1128253273 15:66178724-66178746 CCTCTGAAGGGCTGGGACCCAGG - Intronic
1129051708 15:72786474-72786496 CCTGTGGTGGGCTGTGTCCCTGG - Intergenic
1129460374 15:75697351-75697373 CCCATGGAGGGTGGGGCCCCAGG - Intronic
1129704254 15:77785474-77785496 CCCAGGTAAGGCTGTGTCCCAGG + Intronic
1129716839 15:77857232-77857254 CCCTTGCAGGCCTGGCTCCCAGG + Intergenic
1130312089 15:82764909-82764931 CCCTGGGAGGGCATGGTCCCTGG - Intronic
1135136065 16:19885839-19885861 CCCATATGGGGCTGGTTCCCTGG + Intronic
1135965823 16:27034221-27034243 CCCATGCATGGGAGGGTCCCTGG - Intergenic
1137671453 16:50281913-50281935 CCCCTGGTAGGCTGGGTCTCAGG - Intronic
1137701942 16:50503694-50503716 CCCAGGGAGGGGCGGGTGCCAGG + Intergenic
1137706658 16:50540158-50540180 CCCATGGCAGGCAGGGTTCCTGG - Intergenic
1138672813 16:58629436-58629458 CCCATGGTGGTCTCTGTCCCGGG - Intronic
1141117767 16:81325040-81325062 CCCAGGCAGGGATGGCTCCCAGG + Intronic
1141463446 16:84191688-84191710 GCCACGGAGGGCTGGGTCCCAGG + Intronic
1141672585 16:85500502-85500524 CCCATGGAGATCGGGGACCCAGG - Intergenic
1141811517 16:86379275-86379297 CCCTTGGTGGGCTGCTTCCCTGG - Intergenic
1141825191 16:86473677-86473699 CCCATGGCGGGCTGGGTGTTGGG + Intergenic
1141873674 16:86806835-86806857 CCCAGGGTGGGCAGGGCCCCGGG + Intergenic
1142004067 16:87680698-87680720 CCCTTGGAGAACTGGGTGCCAGG + Intronic
1142211732 16:88811690-88811712 CCGAAGGAGGGCAGGGCCCCGGG + Intronic
1142264728 16:89058464-89058486 CCCCTGGGGGCCTGGGTCCCAGG - Intergenic
1142351929 16:89584525-89584547 TCCGTGGAGGGCTGAGTCGCAGG + Intronic
1142627749 17:1203320-1203342 TCCATGGGGGGCGGGGTCCGCGG + Intronic
1143188064 17:5022463-5022485 CGCCTGGAGGGCTGTGGCCCGGG + Exonic
1143258849 17:5583739-5583761 GGTATGGAGGGCTAGGTCCCAGG + Exonic
1143711987 17:8741719-8741741 CCCAGGAAGGCCTGGGCCCCGGG - Intronic
1143765253 17:9133485-9133507 ACCATGCAGGGCTGGGAGCCAGG + Intronic
1144626070 17:16845064-16845086 CAGATGGAGGGCTGGGCCCATGG - Intergenic
1144880363 17:18427656-18427678 CAGATGGAGGGCTGGGCCCATGG + Intergenic
1145151872 17:20516731-20516753 CAGATGGAGGGCTGGGCCCATGG - Intergenic
1145259534 17:21346605-21346627 CCCTTGGGGTCCTGGGTCCCTGG - Intergenic
1145317083 17:21741343-21741365 CCCTTGGGGTCCTGGGTCCCTGG + Intergenic
1146163241 17:30571002-30571024 CAGATGGAGGGCTGGGCCCGTGG - Intergenic
1147119735 17:38328938-38328960 CCCAGGGAGAGCACGGTCCCTGG - Exonic
1147580217 17:41623761-41623783 CAGATGGAGGGCTGGGCCCGTGG - Intronic
1147668091 17:42161405-42161427 CACAGGGAAGGCTGGCTCCCAGG + Intronic
1148102971 17:45103947-45103969 CCCATGGGAGGCTGCGTCCCGGG - Intronic
1148762374 17:50013281-50013303 CCCAGGGTGGGCTGGTTTCCAGG + Intergenic
1148966300 17:51438745-51438767 CCACTGGAAGGCTGGGACCCAGG - Intergenic
1150229880 17:63544068-63544090 CCCATGGAGTTCTGGCTCCCAGG - Exonic
1150321322 17:64216857-64216879 CCCAGGGAGAGCTGGGTGTCAGG + Intronic
1151500008 17:74482419-74482441 GCCATGGAGGGCTGGCACCAGGG + Intronic
1151786454 17:76277362-76277384 CCCATGGGTGGGTGAGTCCCAGG - Intronic
1151890298 17:76947472-76947494 CCCATGGAGGGCAGGGCTCGTGG + Intronic
1152214686 17:79025207-79025229 GCCATGGAGGGCTGGGTGGTGGG - Intronic
1152568804 17:81112276-81112298 CCCTTGGAGGGCAGAGACCCTGG + Intronic
1152584159 17:81181708-81181730 GCCACGGAGGGGTGGGGCCCAGG + Intergenic
1152605300 17:81286593-81286615 TCGGGGGAGGGCTGGGTCCCCGG - Intronic
1152622648 17:81372944-81372966 CCCGTGGAGGGCTTGGAGCCTGG - Intergenic
1152723922 17:81936016-81936038 CCCAGTGAGGGCAGGGGCCCTGG - Intronic
1152831705 17:82501320-82501342 CCAGTGGAGACCTGGGTCCCAGG + Intergenic
1152889959 17:82874634-82874656 GCCAAGGAGGGATGGGGCCCAGG - Intronic
1155053388 18:22166428-22166450 CTCACAGAGGGCTGGCTCCCGGG - Intergenic
1156476262 18:37407378-37407400 CCCATGAAGTGATGGGACCCAGG - Intronic
1158876039 18:61735504-61735526 CCATTGGAGGGCTTGTTCCCGGG - Intergenic
1159207317 18:65270111-65270133 CCCATGGGGGGCTATGGCCCTGG - Intergenic
1160222582 18:76988256-76988278 GCCTTGCAGGGCTGGGTCCCCGG + Intronic
1160527229 18:79544873-79544895 CCCCGGCAGGGCTCGGTCCCGGG + Intergenic
1160540308 18:79617332-79617354 CCCGGGGAGGGCGGGGTCCCGGG - Intergenic
1160540347 18:79617397-79617419 CCCGGGGAGGGCGGGGTCCCGGG - Intergenic
1160540357 18:79617414-79617436 CCCGGGGGGGGCGGGGTCCCGGG - Intergenic
1160540379 18:79617446-79617468 CCCGGGGAGGGCGGCGTCCCGGG - Intergenic
1160540387 18:79617463-79617485 CCCGGGGAGGGCGGGGTCCCGGG - Intergenic
1160566169 18:79788001-79788023 CCCCGGGAGAGCGGGGTCCCGGG + Intergenic
1160734017 19:653605-653627 CTCATGGATGGCTGGGCCCCTGG + Intronic
1160796780 19:949288-949310 CCCCAGGTGGGCAGGGTCCCTGG - Intronic
1160946836 19:1647638-1647660 CCCTTGGAGGTCTGGGTCCAGGG - Intronic
1160990515 19:1858500-1858522 TTCATTGACGGCTGGGTCCCCGG + Intronic
1161064156 19:2229339-2229361 CCCAGGAAGGCCTGTGTCCCAGG - Intronic
1161167535 19:2796415-2796437 CACAGGGAGTGCTGGGTGCCGGG + Intronic
1161569886 19:5024610-5024632 CCCGTGGTGTGCAGGGTCCCTGG + Intronic
1161658934 19:5534020-5534042 CCGAAGGAGCCCTGGGTCCCTGG + Intergenic
1161962462 19:7530154-7530176 CACATGAATGGCCGGGTCCCGGG - Intronic
1162728120 19:12701900-12701922 TCTGTGGAGGGCTGGGTCACTGG + Intronic
1164388352 19:27795261-27795283 CCCACAGAGGCCTGGGTACCAGG + Intergenic
1164462289 19:28459216-28459238 CCCATGGAGGGTTGGGATCTGGG + Intergenic
1165329204 19:35131938-35131960 CTCATGGAGGGCTGGGGCGGTGG + Intronic
1165978114 19:39694693-39694715 CCCATGGAGGGCTGGGTACTGGG - Intergenic
1166201282 19:41239293-41239315 CCCCTGGAGGCCTGGCGCCCAGG + Exonic
1166390726 19:42407514-42407536 CCCATGGAGGGGTGCAGCCCTGG - Intronic
1166418326 19:42612420-42612442 CCTACTGAGGGCTGGGTCACGGG + Intronic
1166502839 19:43354060-43354082 CCCCCGGAGGGGTGGCTCCCGGG - Intronic
1166830921 19:45639259-45639281 CCCACGCCGGTCTGGGTCCCAGG + Intronic
1167331199 19:48857429-48857451 ACCATGGAGGCCCGGGTCCCAGG + Exonic
1167562116 19:50232109-50232131 CCCACGGAGAGCTGGGGACCTGG + Intronic
1167596862 19:50432549-50432571 CGCCTGGACGCCTGGGTCCCGGG - Intergenic
1168273958 19:55265964-55265986 CCCATGGAGCACAGGGTCCCTGG + Exonic
1168279575 19:55297566-55297588 CCCATGGAGTGGTGAGCCCCAGG - Intronic
925293875 2:2765447-2765469 TCCATGGTGGCCTGGTTCCCAGG + Intergenic
925436558 2:3843190-3843212 CCCAGGCAGGGGTGGGACCCAGG + Intronic
925922492 2:8646955-8646977 GCCATCCAGGGCCGGGTCCCTGG + Intergenic
925985485 2:9211713-9211735 CCCATGGACGGCAGGGCCCCTGG - Intronic
926113411 2:10196613-10196635 CCCATGGGGGGCCGGGCTCCGGG + Intronic
927101148 2:19788770-19788792 ACCTTGGAGGGCTGGGGCACTGG - Intergenic
927197038 2:20555246-20555268 CCCAAGGTGGGCAGGGTCCACGG + Intergenic
927551420 2:24003529-24003551 CCCATGGAAGGCTGGGAGCTAGG - Exonic
927783097 2:25954906-25954928 GCCACTGAGGGCTGGGTCCGTGG + Intronic
927818738 2:26244405-26244427 CCCACAGAGGGCTGCGTCTCCGG + Intronic
929026945 2:37614088-37614110 CCCAGGGAGGCCTGGGTAACAGG + Intergenic
929539899 2:42811246-42811268 CCCAGGGACGGCTGGGCGCCTGG - Intergenic
933685945 2:85141304-85141326 CCCATGGAGGGAAGTGTTCCAGG + Intronic
934176274 2:89582475-89582497 TCCATGCAGAGCTGGGCCCCTGG + Intergenic
934286584 2:91656836-91656858 TCCATGCAGAGCTGGGCCCCTGG + Intergenic
935671004 2:105557173-105557195 CGCATGCAGGGCTGAGTGCCAGG - Intergenic
936047467 2:109198609-109198631 CCCAGTGAGGGCTGTCTCCCTGG + Intronic
937140562 2:119596342-119596364 CCCATGGAGGGCAGGGCGACTGG - Intronic
937248770 2:120510606-120510628 TCCATGAAGGGCTGGGTGCAGGG - Intergenic
937252481 2:120533615-120533637 CCCGTGGGGAGATGGGTCCCAGG - Intergenic
938365055 2:130727722-130727744 GCTATGGAGGGCGTGGTCCCAGG + Intergenic
938807628 2:134821532-134821554 CCCATGGAGTGATGGGGACCAGG - Intergenic
942564724 2:177255106-177255128 CTCTTGGAAGTCTGGGTCCCCGG - Intronic
944863108 2:203834289-203834311 TCCTCGGAGGTCTGGGTCCCAGG - Intergenic
946352161 2:219162239-219162261 CCCAGGGAGGGATGGCTTCCTGG + Intronic
947542776 2:230990336-230990358 GCCCTGCAGGGCTGGGCCCCAGG - Intergenic
947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG + Intronic
948830303 2:240595355-240595377 CCCATGGAGGTCTGGGTTCTAGG + Intronic
948835718 2:240625117-240625139 CCCTGGGAGGGCTGGGCCCTGGG + Intronic
949035492 2:241814134-241814156 CACATGGCTGGCAGGGTCCCGGG + Intronic
1168894255 20:1312869-1312891 GCCATGCAGAGCTGTGTCCCTGG - Intronic
1169020367 20:2326440-2326462 CCCATCAGGGGTTGGGTCCCAGG + Intronic
1169354888 20:4897960-4897982 CCCATGGAGCACTGGTTCTCTGG - Intronic
1171437179 20:25132863-25132885 CCGCTGGAGGGCTGGGGCTCGGG + Intergenic
1172099262 20:32475554-32475576 CCCCTGGAGGGCTGGGTTGAAGG - Intronic
1175400922 20:58699436-58699458 CCCAGGGACGGCTGCTTCCCAGG - Intronic
1175718192 20:61269335-61269357 TCCATGGGGGGCTGGTTCCAAGG - Intronic
1175782428 20:61690978-61691000 CCCAGGAAGGGCTGGGCCTCTGG - Intronic
1176146657 20:63568493-63568515 CTCATCGCGGGCTGGGGCCCTGG - Exonic
1176261379 20:64182659-64182681 GCCAGGGAGGGCTGGGTCCAGGG - Intronic
1176390329 21:6159912-6159934 CCCATGCACACCTGGGTCCCAGG - Intergenic
1176390337 21:6159946-6159968 CCTATGGACACCTGGGTCCCAGG - Intergenic
1176623893 21:9075278-9075300 CCCATGCAGGGCAGGATGCCAGG + Intergenic
1178910175 21:36667763-36667785 CCCATTGAGGGCTGGGTGCATGG + Intergenic
1179066590 21:38030258-38030280 CCCATAGAGGACAGGGTGCCTGG + Intronic
1179733129 21:43378294-43378316 CCTATGGACACCTGGGTCCCAGG + Intergenic
1179733137 21:43378328-43378350 CCCATGCACACCTGGGTCCCAGG + Intergenic
1180080250 21:45483390-45483412 CCGAAGGAAGGCTGGGTCCATGG - Intronic
1180614439 22:17118756-17118778 CCCAGGAAGAGCTGGGCCCCTGG - Exonic
1180801394 22:18633799-18633821 CCCTGGCAGGGCTGGGTCCCGGG - Intergenic
1180993620 22:19953637-19953659 CCCAGGCAGGGCAGGCTCCCGGG + Intronic
1181068335 22:20317033-20317055 CCCCAGGAGGGAGGGGTCCCTGG + Intronic
1181220327 22:21361462-21361484 CCCTGGCAGGGCTGGGTCCCGGG + Intergenic
1181479822 22:23191676-23191698 CCCATGGAGGTCTGTGTCTCGGG + Intronic
1181648632 22:24247058-24247080 GCCCTGGAGGGCTGTGTCTCTGG - Intergenic
1182091324 22:27596875-27596897 CCCATGGAGGGCTGTTTGCTGGG - Intergenic
1183428857 22:37753834-37753856 CCCTGGGAGGGCTGGGGACCGGG + Intronic
1183893619 22:40950841-40950863 CCGTGGGAGGGCTGGGGCCCAGG - Intergenic
1184643415 22:45883941-45883963 CCCAGGGAGGGGTGGGTCCGAGG - Intergenic
1185081204 22:48710359-48710381 GGCAGGGAGGGCTGGGTCCAGGG - Intronic
1185137588 22:49081422-49081444 CGCATGAAGGGGTGGGTGCCCGG + Intergenic
1185242705 22:49755163-49755185 CCCTGGGAGGACAGGGTCCCTGG + Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185320011 22:50196297-50196319 CCCAGGGTGGCCTGGGCCCCGGG + Intronic
950117361 3:10460079-10460101 ACCATGGAGGGCTGGGGCCTAGG + Intronic
954646980 3:52137612-52137634 CCCTGGGTGGGCTGGGTCCCTGG - Intronic
956017633 3:64900493-64900515 CCCATGGAGTGGCAGGTCCCAGG + Intergenic
957073154 3:75581144-75581166 TCCCTGCACGGCTGGGTCCCAGG - Intergenic
958919627 3:100090118-100090140 TCCATGGAGGGCTTGTTCCAAGG + Intronic
960207288 3:114918235-114918257 CACATGGAAGGATGAGTCCCAGG - Intronic
960333986 3:116393515-116393537 CCCTTGGAGGTGTGGGACCCAGG + Intronic
961155285 3:124674532-124674554 GCCGCCGAGGGCTGGGTCCCAGG + Intronic
961280927 3:125765636-125765658 CCCCTGCACAGCTGGGTCCCAGG + Intergenic
961385003 3:126518234-126518256 CCACTGGAGGGCTGGGTGACAGG + Intergenic
961524169 3:127486043-127486065 CCGATGGAGGGGTGGGGACCAGG + Intergenic
961557519 3:127706808-127706830 CCCGTGGAAGGCTGTGTCCTGGG + Intronic
961873466 3:130003949-130003971 TCCCTGCACGGCTGGGTCCCAGG - Intergenic
962331825 3:134485454-134485476 CCCCTGGAGGGGTGGGTACCGGG - Exonic
963192991 3:142494275-142494297 TCCATGGAGGGATTGGTCCCAGG - Intronic
963454130 3:145522302-145522324 CCCTTGGAGGCATGGGACCCAGG - Intergenic
963803220 3:149697899-149697921 CCCATGCAGGTCTGGAACCCAGG + Intronic
966840288 3:184082319-184082341 CCCTTGGAGGGGTGGGATCCAGG + Intergenic
967230507 3:187333380-187333402 CCCACGGAGGGCTGTGTCCTAGG + Intergenic
967488075 3:190057374-190057396 ACCATGGAAGGCTAAGTCCCAGG + Intronic
967888008 3:194346260-194346282 CCCACGGAGGCCGGGGTCCTGGG + Intronic
968427201 4:531963-531985 ACCAGGGAGGGCTGGGTCCTGGG - Intronic
968486683 4:866327-866349 GCCATGGAGAGCTGGCTGCCAGG + Intronic
968555185 4:1243359-1243381 CCCAGGGAGTGCAGGGCCCCAGG - Intronic
968722775 4:2219969-2219991 CCTATGGTGGGCTGGGTCTGAGG - Intronic
968941453 4:3640816-3640838 CCCACGGACGGCTTTGTCCCTGG - Intergenic
969299826 4:6291382-6291404 CCCAGGGAAGGCTGGTGCCCAGG - Intronic
969637476 4:8377752-8377774 ACCAAGGTGGGCTGGGGCCCAGG + Intronic
969642142 4:8405317-8405339 CACATGGAGGCCTGGGTGGCCGG - Intronic
969737206 4:8999877-8999899 TCCCTGCACGGCTGGGTCCCAGG + Intergenic
969796401 4:9531465-9531487 TCCCTGCAGGGCTGGGTCCCAGG + Intergenic
973627998 4:52791754-52791776 CCCTAGGAGGTCTGGGTCCATGG - Intergenic
973636208 4:52863454-52863476 GCCATGGAGGGCTGGGGACTGGG - Intronic
985292810 4:188404126-188404148 TTCATGGAGGGCCAGGTCCCTGG + Intergenic
985673568 5:1218858-1218880 CCCACGGAGGGCAGAGGCCCTGG + Intronic
986024905 5:3841547-3841569 CTCATGGAGGGCTGGGGCGGGGG + Intergenic
987025889 5:13926105-13926127 ACCATGGAGGGCAGGGACCTAGG + Intronic
987031104 5:13977699-13977721 CCCATCCTGGGCTGGGACCCAGG - Intergenic
988991169 5:36672317-36672339 TCCATAGAGGCCTGGATCCCAGG + Intronic
990615319 5:57501765-57501787 CCCTTAGAGAGCTGGGCCCCAGG + Intergenic
991016715 5:61940946-61940968 CCCAAGGAGCTCTGGGTTCCTGG + Intergenic
992187394 5:74257419-74257441 CACATGGTGGGCTGGGACCTGGG - Intergenic
994757185 5:103808952-103808974 CCCATGAAGGGCTGGATTCTTGG + Intergenic
997780640 5:136654290-136654312 GCCCTGGAGGGCAGGATCCCAGG + Intergenic
999902087 5:156095626-156095648 CCCCTCCAGGGCTGGATCCCTGG + Intronic
1000877203 5:166655583-166655605 TCCATGGAGGGATGGGCCCTTGG + Intergenic
1001975418 5:175994757-175994779 ACTCAGGAGGGCTGGGTCCCAGG + Intronic
1002242015 5:177849013-177849035 ACTCAGGAGGGCTGGGTCCCAGG - Intergenic
1002291881 5:178205463-178205485 CCCTGGGCGGGCTTGGTCCCCGG + Intronic
1003393369 6:5732309-5732331 TCCATGGAGGGCAGTGACCCAGG + Intronic
1004701946 6:18087618-18087640 CCCCTGCAGGGTTGGGTCCTGGG - Intergenic
1005938561 6:30543926-30543948 ACCATGGAGGTCTGGGGCTCTGG - Exonic
1006447516 6:34088033-34088055 CCCAGGTAGGGCTGGGACCCAGG + Intronic
1006463521 6:34177532-34177554 CCCAGGGAGGGCTGGCTGCTGGG - Intergenic
1007299241 6:40853840-40853862 GCCCTTGAGGGCTGGGTCCTGGG + Intergenic
1008220267 6:48845645-48845667 TCCATGGAAGTATGGGTCCCTGG + Intergenic
1011170935 6:84503799-84503821 CCAATGTAGAGCTGGGGCCCTGG + Intergenic
1011577592 6:88820297-88820319 AACATGGAGGGCTGGGTAACTGG - Intronic
1017111875 6:150940270-150940292 CCCATGGAGGTCTGAGTGTCAGG + Intronic
1018613551 6:165664019-165664041 ACCATGGCGCGCTGGGTCCGAGG + Intronic
1019394204 7:808310-808332 ACCCAGGAGAGCTGGGTCCCAGG - Intergenic
1019578658 7:1749535-1749557 CCTTTGGAGGGCTGAGTCACAGG - Intergenic
1020812592 7:12864662-12864684 CCCCTAGAGGGCTGGGCTCCCGG + Intergenic
1021078174 7:16330878-16330900 CACATGGAGGGCTGGGTGTTTGG - Intronic
1021131288 7:16915800-16915822 TCCATGGTGGGCTGGTCCCCCGG + Intergenic
1023966705 7:44966640-44966662 CCCATGGAGTGATGGGTGTCAGG + Intronic
1024035909 7:45507032-45507054 CCCCTGGATGCCTGGCTCCCTGG + Intergenic
1025200429 7:56958161-56958183 CCCAGGAAGGGCTTGGTCTCAGG - Intergenic
1025639360 7:63352929-63352951 CCCACAGAGGCCTGGGTACCAGG - Intergenic
1025643339 7:63395163-63395185 CCCACAGAGGCCTGGGTACCAGG + Intergenic
1025671514 7:63618771-63618793 CCCAGGAAGGGCTTGGTCTCAGG + Intergenic
1025723991 7:64041563-64041585 CAGCTGGAGTGCTGGGTCCCAGG + Intronic
1026582508 7:71630087-71630109 CCCCTGGATGTCTGGATCCCAGG - Intronic
1026953860 7:74364563-74364585 CAGATGGGGGGCTGGGCCCCAGG + Intronic
1029075227 7:97929238-97929260 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1029283309 7:99450378-99450400 GCCAGGGTGGGCTGGGCCCCGGG + Intronic
1033030460 7:137820952-137820974 CCCCTCTAGGGCTGGGCCCCAGG - Intronic
1034433177 7:151050975-151050997 CCCATGGCGGGCAGGGCCCAGGG + Intronic
1035235823 7:157497135-157497157 CAGAGGGAGGGCTGGGTCTCGGG - Intergenic
1035315772 7:157997060-157997082 CCCAGGGAGGGCTCGGCCCCAGG + Intronic
1035659336 8:1334953-1334975 GCCTGCGAGGGCTGGGTCCCGGG - Intergenic
1035744231 8:1950208-1950230 CCCAGATGGGGCTGGGTCCCGGG - Intronic
1036242293 8:7091140-7091162 CCCCTGCACGGCTGGGTCCCAGG + Intergenic
1036258496 8:7222872-7222894 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036307070 8:7610508-7610530 CCCCTGCACGGCTGGGTCCCAGG + Intergenic
1036310551 8:7681468-7681490 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036357917 8:8058495-8058517 CCCCTGCACGGCTGGGTCCCAGG + Intergenic
1036830443 8:12015990-12016012 CCCCTGCACGGCTCGGTCCCAGG - Intergenic
1036893031 8:12608451-12608473 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036899525 8:12660290-12660312 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1036900589 8:12666437-12666459 CCCCTGCACGGCTGGGTCCCAGG - Intergenic
1037400936 8:18494630-18494652 CCCATGAAGTGCTGAGTCCTGGG + Intergenic
1039884887 8:41649183-41649205 CCCATGGAGGGGTGGCTGTCAGG + Intronic
1039972380 8:42331202-42331224 CCCACGGAGGGCTGCGTCCTGGG - Exonic
1041098532 8:54373474-54373496 CCCCTGGGGTGCTGGCTCCCCGG - Intergenic
1047911774 8:129537832-129537854 TCCATGGAGCGCTGTGTCCCAGG + Intergenic
1049316432 8:141971307-141971329 CCCAGGGAGTGCTTGGCCCCTGG - Intergenic
1049381446 8:142318395-142318417 GCCATGGGAGGCTGGGTGCCAGG + Intronic
1049475221 8:142794183-142794205 CCGAGGGAGGTCTGGGTCCAGGG - Intergenic
1049718638 8:144105361-144105383 CCCAGGGTGAGCAGGGTCCCCGG + Intronic
1057217648 9:93238329-93238351 CCCCTGAAGGGCTGGGTTCTGGG + Intronic
1059415526 9:114159993-114160015 CCCATGGTGAGCTGGGGGCCTGG + Intronic
1060421197 9:123470871-123470893 CTCATGCAGGGCTGAGTCTCTGG + Intronic
1060976963 9:127770581-127770603 CAGATGGAGCACTGGGTCCCGGG + Intronic
1061075004 9:128335876-128335898 CACAGGGAAGGCTGGGGCCCTGG - Intergenic
1061439172 9:130588081-130588103 CCCATGTTGTGCTGGGTGCCAGG + Intronic
1061826095 9:133259217-133259239 GCCTTGGAGGGCTGTTTCCCAGG - Intronic
1061872772 9:133529526-133529548 CCAAGGGCAGGCTGGGTCCCGGG - Intergenic
1061898998 9:133663396-133663418 CACATGGAGGCCTGGGACCAAGG - Intergenic
1061955024 9:133956842-133956864 CCCACAGAGGGCTCTGTCCCAGG - Intronic
1062216016 9:135390283-135390305 CCCAGGCAGGGCTGGGGCCCTGG + Intergenic
1203747078 Un_GL000218v1:45706-45728 CCCATGCAGGGCAGGATGCCAGG + Intergenic
1186819445 X:13272039-13272061 CCCTCGAAGGGCTGGGGCCCAGG - Intergenic
1186933466 X:14420527-14420549 CCCTTTGAGAGCTGCGTCCCTGG - Intergenic
1187018689 X:15357333-15357355 CCCATGGAGGGCAGCGTCCTGGG - Intronic
1188265393 X:28067152-28067174 CCCTTGGAGGGCTGGGGAGCTGG + Intergenic
1189037135 X:37505159-37505181 CCAGTGGAGGGCAGGGTCCTCGG - Intronic
1189282894 X:39831708-39831730 CCCATGGAAGGATTGGTTCCAGG + Intergenic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1190641226 X:52483627-52483649 CCCACAGAGGCCTGGGTGCCAGG - Intergenic
1190646446 X:52529238-52529260 CCCACAGAGGCCTGGGTGCCAGG + Intergenic
1191771924 X:64770178-64770200 CCCATTGGGGGCTGGGGGCCGGG - Intergenic
1192089674 X:68140606-68140628 CCCCTGAAGGGCTGGGCTCCCGG + Intronic
1199982203 X:152927405-152927427 GCCATGGAGGGCTGGGTCAGCGG - Intronic
1201160399 Y:11160701-11160723 CCCATGCAGGGCAGGATGCCAGG + Intergenic