ID: 947919640

View in Genome Browser
Species Human (GRCh38)
Location 2:233857955-233857977
Sequence TTTCTTAGCAGCCTAATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947919640_947919646 24 Left 947919640 2:233857955-233857977 CCACCTATTAGGCTGCTAAGAAA No data
Right 947919646 2:233858002-233858024 TAGAGCTGATGCAAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947919640 Original CRISPR TTTCTTAGCAGCCTAATAGG TGG (reversed) Intergenic
No off target data available for this crispr