ID: 947925161

View in Genome Browser
Species Human (GRCh38)
Location 2:233914836-233914858
Sequence CCTGCCAAGAAGGTAAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947925155_947925161 9 Left 947925155 2:233914804-233914826 CCTCATCAAGGCCTCAGGGGGAG No data
Right 947925161 2:233914836-233914858 CCTGCCAAGAAGGTAAGATCAGG No data
947925157_947925161 -2 Left 947925157 2:233914815-233914837 CCTCAGGGGGAGGCCTGAGCTCC No data
Right 947925161 2:233914836-233914858 CCTGCCAAGAAGGTAAGATCAGG No data
947925149_947925161 23 Left 947925149 2:233914790-233914812 CCTGAGGCTTCTCTCCTCATCAA No data
Right 947925161 2:233914836-233914858 CCTGCCAAGAAGGTAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947925161 Original CRISPR CCTGCCAAGAAGGTAAGATC AGG Intergenic
No off target data available for this crispr