ID: 947930499

View in Genome Browser
Species Human (GRCh38)
Location 2:233960957-233960979
Sequence CGTGAGGAGGGCATCATTAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947930499_947930506 19 Left 947930499 2:233960957-233960979 CCTATAATGATGCCCTCCTCACG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 947930506 2:233960999-233961021 CGAACTTCCGAAGAGGCTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 50
947930499_947930504 -7 Left 947930499 2:233960957-233960979 CCTATAATGATGCCCTCCTCACG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 947930504 2:233960973-233960995 CCTCACGTTTGTCTGGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 75
947930499_947930507 23 Left 947930499 2:233960957-233960979 CCTATAATGATGCCCTCCTCACG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 947930507 2:233961003-233961025 CTTCCGAAGAGGCTTCCGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 67
947930499_947930505 12 Left 947930499 2:233960957-233960979 CCTATAATGATGCCCTCCTCACG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 947930505 2:233960992-233961014 CTGGTTGCGAACTTCCGAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947930499 Original CRISPR CGTGAGGAGGGCATCATTAT AGG (reversed) Exonic
902649920 1:17830307-17830329 CCTGAGGTAGGCATCTTTATTGG - Intergenic
916150801 1:161787476-161787498 AGTGAGGAGGGCATCCGCATGGG - Intronic
919704188 1:200660507-200660529 GGTGAGGAGGGCATCGCTGTGGG + Intronic
1065001008 10:21337547-21337569 AATGAGGAGGGCATCATCAATGG - Intergenic
1067660558 10:48233848-48233870 CCTGAGGAAGGCATCACTAGGGG - Intronic
1071025608 10:81109221-81109243 CTAGAGGAGGGCTCCATTATAGG - Intergenic
1072289641 10:93952305-93952327 AGTGAGGAGGGCTTCAGTACAGG + Intronic
1074840035 10:117341972-117341994 CCTGAAGAGGGCAATATTATTGG + Intronic
1077942141 11:6854594-6854616 TGAGAGGGGGCCATCATTATGGG - Intergenic
1085453467 11:76652967-76652989 AGTGAGGAGGGAGACATTATTGG + Intergenic
1088606132 11:111534759-111534781 AGTCAGGAGGGCATGATGATGGG - Intronic
1098836011 12:75425191-75425213 GGTGAGGAGAGCATCAACATGGG + Intronic
1104516776 12:129434429-129434451 TATGAGGAGGGTATCACTATTGG - Intronic
1110756266 13:79178377-79178399 AGTGAGGAGGGCACTATTCTAGG - Intergenic
1114559448 14:23579535-23579557 GGGGAGGAGGGCATCATGCTTGG + Intergenic
1120055478 14:79919247-79919269 AGGGAGGAAGGCATTATTATAGG - Intergenic
1120573602 14:86152712-86152734 CCTGAGGAGTGCTTCATGATGGG + Intergenic
1123068962 14:105631904-105631926 TGTGAGAAGGACATGATTATGGG - Intergenic
1123073119 14:105651862-105651884 TGTGAGAAGGACATGATTATGGG - Intergenic
1123093039 14:105750632-105750654 TGTGAGAAGGACATGATTATGGG - Intergenic
1123098512 14:105777729-105777751 TGTGAGAAGGACATGATTATGGG - Intergenic
1123107426 14:105849127-105849149 TGTGAGAAGGACATGATTATGGG + Intergenic
1125308471 15:38350517-38350539 AGTGAGAAGGGCATGATTTTGGG - Intronic
1125599796 15:40909139-40909161 CGTGAGCAGGGCACCATCCTAGG + Intergenic
1126938248 15:53736264-53736286 TATGAGGAGGGCATCAGGATAGG + Intronic
1138057156 16:53847269-53847291 GGTGAGGAGGGCATCCCTACGGG - Intronic
1138722945 16:59103042-59103064 TGTGAGGAGTTCATTATTATTGG - Intergenic
1147638906 17:41981857-41981879 GATGAGGAGGGCATGAATATGGG - Exonic
1153770215 18:8409260-8409282 CGTGAGGTGGCCATCAAAATGGG + Intergenic
1156437739 18:37151865-37151887 GGTGAGGAGGGCTTCCATATGGG + Intronic
1160036469 18:75305868-75305890 CTTGAGCAGGGAACCATTATTGG - Intergenic
925083943 2:1093100-1093122 AGTGAGGAGGCCGTGATTATGGG + Intronic
925256712 2:2495965-2495987 ACAGAGGAGGGGATCATTATGGG + Intergenic
927103588 2:19806325-19806347 CGGGAGGAGGGCATCTGGATTGG + Intergenic
930383153 2:50657521-50657543 CATGAGTATGGCATCATTCTGGG - Intronic
931903774 2:66820892-66820914 TGTGAGGACGCCATCATTGTGGG - Intergenic
932362283 2:71118812-71118834 AGTGAGGAGGGCATCAGCATGGG - Intronic
933394777 2:81717294-81717316 TGGGAGAAGGGCATAATTATTGG + Intergenic
937244490 2:120483759-120483781 CGTGGGGAGGCCATCATCATGGG + Intergenic
937955643 2:127420440-127420462 CGGGAGGAGGCCATGATTCTTGG + Intronic
938724739 2:134097329-134097351 TGAGGGGAGGGAATCATTATGGG + Intergenic
947930499 2:233960957-233960979 CGTGAGGAGGGCATCATTATAGG - Exonic
1181886118 22:26023649-26023671 CCTGAGGAGGGCAACATTGAGGG - Intronic
1182142036 22:27967776-27967798 GGTGAGGAGGGCATCCTTTGGGG - Intergenic
1182966117 22:34522540-34522562 GGTGAGGATGGCATCTTGATTGG - Intergenic
1183044322 22:35207628-35207650 CGTGAGAAGGACATAATTTTGGG - Intergenic
952433653 3:33250029-33250051 GGTGAGGAGGGCATGGTTAATGG - Intergenic
955767003 3:62355320-62355342 CATGAGGAGGCCAGCATAATTGG + Intergenic
958479241 3:94626195-94626217 AGTGAGGAGGGCATCCGTTTTGG - Intergenic
960172870 3:114483239-114483261 TATGAGGAAGACATCATTATGGG - Intronic
960951603 3:123002178-123002200 AGTCTGGAGGGCATCATTCTTGG + Intronic
962582580 3:136811735-136811757 GGTGAGGAGGGCAGATTTATTGG + Intergenic
964501406 3:157352162-157352184 AGTAAGGAGGGCAACAATATTGG - Intronic
965250320 3:166334596-166334618 CATGAGGTGGTCATCATTAAAGG - Intergenic
966857699 3:184206748-184206770 CCTGAGGAGGGCATCTGTGTAGG + Intronic
969385131 4:6839828-6839850 AGTGAGGAGGTCATCACTGTGGG + Intronic
974810880 4:66944370-66944392 TATGAGGAGGGCATAATAATTGG + Intergenic
976311873 4:83621084-83621106 GGTGAGGAAGGCATCTATATGGG - Intergenic
981554363 4:145976915-145976937 GGTGAGGAGGGCACCCGTATGGG + Intergenic
982416765 4:155142621-155142643 CGTAAGGAAGGCAACATTACTGG - Intergenic
982692528 4:158565046-158565068 GGTGAGAAGGGCATCCTTAGAGG + Intronic
991616911 5:68506388-68506410 TTAGAGGAGGGCATCATTACGGG - Intergenic
992106451 5:73452123-73452145 CGTCAGGAGGACCTCATCATCGG - Intergenic
992509230 5:77416840-77416862 GGTGGGGAGGTCATCATTTTTGG - Intronic
994527904 5:100929428-100929450 GGTAAGGGCGGCATCATTATTGG - Intergenic
1000055518 5:157602720-157602742 CGTCAGGAGGGCATCTGTAGAGG + Intergenic
1001451345 5:171827030-171827052 GGGGAGGAGGGCATCCATATAGG + Intergenic
1003826344 6:9956462-9956484 GGGTAGGAGGGCATCATTTTAGG + Intronic
1004484057 6:16049000-16049022 GGTGAGGAGGGGATCATGATTGG - Intergenic
1006216073 6:32443824-32443846 GGTCTGGTGGGCATCATTATTGG + Exonic
1010767354 6:79791294-79791316 GATGAGGAGGGCATCTTTGTGGG - Intergenic
1010845121 6:80697039-80697061 CATGGAGAGGGCATCACTATGGG + Intergenic
1013277874 6:108603688-108603710 GGAGAGGAGGGAATCATTGTTGG + Intronic
1014631056 6:123790271-123790293 CTTGAGGAAGGCAGGATTATTGG + Intergenic
1016661851 6:146590345-146590367 CTTGAGTAGGGCATCACTATGGG - Intergenic
1021179452 7:17488885-17488907 AGAGAGGAGGGCATCATGTTGGG - Intergenic
1024849320 7:53692067-53692089 GGTCAGGAGGGCATCTTTCTCGG - Intergenic
1028722452 7:94049065-94049087 GGAGAAGAGGGCATCATTAATGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1035263253 7:157674906-157674928 CGGGAGGAGGGCATCGTTGTTGG - Intronic
1039828572 8:41195132-41195154 CGGAAGGCGGGCATCATCATGGG - Intergenic
1042625480 8:70751931-70751953 CATGAGACGGGCTTCATTATGGG - Intronic
1047689428 8:127336175-127336197 TGTGAGGTGGGAATCATCATGGG - Intergenic
1051048294 9:12901616-12901638 TGTGAGGAGGGCATCTGTGTGGG - Intergenic