ID: 947933370

View in Genome Browser
Species Human (GRCh38)
Location 2:233982972-233982994
Sequence TCCACTGAGGACGGCCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947933362_947933370 3 Left 947933362 2:233982946-233982968 CCTGGAACCGCTGCTCTTCTCCA 0: 1
1: 0
2: 1
3: 19
4: 211
Right 947933370 2:233982972-233982994 TCCACTGAGGACGGCCGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 120
947933364_947933370 -4 Left 947933364 2:233982953-233982975 CCGCTGCTCTTCTCCATGGTCCA 0: 1
1: 0
2: 0
3: 38
4: 426
Right 947933370 2:233982972-233982994 TCCACTGAGGACGGCCGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 120
947933361_947933370 4 Left 947933361 2:233982945-233982967 CCCTGGAACCGCTGCTCTTCTCC 0: 1
1: 0
2: 4
3: 14
4: 172
Right 947933370 2:233982972-233982994 TCCACTGAGGACGGCCGGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947933370 Original CRISPR TCCACTGAGGACGGCCGGGC CGG Intronic