ID: 947934347

View in Genome Browser
Species Human (GRCh38)
Location 2:233990691-233990713
Sequence GGTGTTCTAACCACGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947934346_947934347 -9 Left 947934346 2:233990677-233990699 CCTTTTTGCTGTAGGGTGTTCTA 0: 1
1: 0
2: 0
3: 10
4: 128
Right 947934347 2:233990691-233990713 GGTGTTCTAACCACGAGCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 64
947934345_947934347 -5 Left 947934345 2:233990673-233990695 CCTGCCTTTTTGCTGTAGGGTGT 0: 1
1: 0
2: 1
3: 11
4: 122
Right 947934347 2:233990691-233990713 GGTGTTCTAACCACGAGCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947934347 Original CRISPR GGTGTTCTAACCACGAGCTC AGG Intronic
900396800 1:2456394-2456416 GGCGCTCTAGCCACGCGCTCTGG + Intronic
900649041 1:3722169-3722191 GCTGCCCCAACCACGAGCTCGGG + Exonic
901754156 1:11430871-11430893 GATGTCCTAACCACGAGCCCAGG - Intergenic
909687285 1:78364434-78364456 GGTGGGCTAATCACGAGATCAGG - Intronic
914714355 1:150241885-150241907 GGTGGGCAAACCACGAGGTCAGG - Intergenic
915109911 1:153557023-153557045 GGTGTGCAGACCACGAGGTCAGG + Intergenic
921615424 1:217260804-217260826 GGTCTTCTATCCAAGAGCTATGG - Intergenic
1078490350 11:11762502-11762524 GGTCTTCTAACCTCCAGCTCAGG + Intergenic
1084012840 11:66362301-66362323 GGTGCTCTGCCCAGGAGCTCAGG + Intronic
1084026934 11:66456518-66456540 GATGTTCTAACCATGAGCCCAGG - Intronic
1084614788 11:70228413-70228435 GGTGGACAAATCACGAGCTCAGG + Intergenic
1085992733 11:81869899-81869921 GATGCTCTAACCACAAGCCCAGG - Intergenic
1086174091 11:83869409-83869431 GGTGTTCTGAGCCTGAGCTCAGG - Intronic
1093359553 12:18206566-18206588 TGTGTGCTAATCACGAGTTCAGG - Intronic
1100130953 12:91492767-91492789 GGTGTTCTAACAACCAGGCCAGG - Intergenic
1100831935 12:98524342-98524364 GGTGGGCAAATCACGAGCTCAGG + Intronic
1110575898 13:77054446-77054468 GGGGTTCTACACCCGAGCTCAGG + Intronic
1113977551 13:114240436-114240458 GGTGGGCAAACCACGAGGTCAGG - Intronic
1114520271 14:23329710-23329732 GGTGGGTTAACCACGAGATCAGG - Intergenic
1115056130 14:29129426-29129448 TGTGTTTTAAACATGAGCTCTGG - Intergenic
1117162494 14:53002817-53002839 TGTGGTCTAGCCATGAGCTCAGG + Intergenic
1124808413 15:32909164-32909186 TGTGTTGTTACCATGAGCTCAGG - Intronic
1133787643 16:8985663-8985685 GGTGTGCGAATCACGAGGTCAGG - Intergenic
1133876204 16:9737077-9737099 GGTGTCCTAACCATGAGCCTGGG - Intergenic
1140503435 16:75454387-75454409 GGTGGGCTAATCACGAGGTCAGG + Intronic
1143413006 17:6723559-6723581 GGTGGGCGAACCACGAGGTCAGG - Intergenic
1148752051 17:49950966-49950988 GGTGGGCTGATCACGAGCTCGGG + Intergenic
1149543980 17:57489473-57489495 GGGGTTCTGACCATGAGCTTTGG + Intronic
1151746506 17:76014494-76014516 GGTGCTCCAGCCAGGAGCTCAGG + Exonic
1152598132 17:81248184-81248206 GGTGTGCGAATCACGAGGTCAGG - Intronic
1155859168 18:30874944-30874966 GATGTTCTAACCATGAGCCCAGG - Intergenic
1160168446 18:76532750-76532772 GTTGTTGCAACCACGGGCTCTGG + Intergenic
1166882562 19:45938316-45938338 GGTGTGCTCACCAGGGGCTCTGG - Exonic
1167760185 19:51441708-51441730 GATGTTTTGACCACGAGCCCAGG - Intergenic
925672391 2:6325398-6325420 GGTCTTCTACGCAGGAGCTCCGG + Intergenic
935106526 2:100049982-100050004 GGTGGACAAACCACGAGGTCAGG + Intronic
940777636 2:157901408-157901430 GATCTCCTAACCACGACCTCAGG - Intronic
943134921 2:183897994-183898016 GGTGTTCTAACCAGGAGCCCAGG + Intergenic
947934347 2:233990691-233990713 GGTGTTCTAACCACGAGCTCAGG + Intronic
947963383 2:234258828-234258850 GGTGTTCTTACCTATAGCTCGGG - Intergenic
1169665318 20:8027859-8027881 GGTGTTCTCATCTGGAGCTCAGG - Intergenic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1174106100 20:48163409-48163431 GATATTCTAACCACAAGCCCAGG - Intergenic
1174999927 20:55616344-55616366 GATGTTCTAATCACGAGCTCAGG + Intergenic
1175585835 20:60139011-60139033 GATGGTCTAACCACGAGCCTGGG + Intergenic
951088049 3:18538115-18538137 TGTGGTCCAACCACGATCTCTGG + Intergenic
955256058 3:57332763-57332785 GGTGCTGTAACCAGGAGATCTGG + Intronic
957461854 3:80532389-80532411 GGTGGGCTAATCACGAGGTCAGG - Intergenic
958830000 3:99074867-99074889 GGTGTTATAACCAGAAGCCCAGG - Intergenic
959892516 3:111571942-111571964 GATGTTCTAACCATGAGCCCAGG - Intronic
974680152 4:65150007-65150029 GGTGGGCTAATCACGAGGTCAGG + Intergenic
978267318 4:106841927-106841949 GATATTCTAACCACAAGCCCTGG - Intergenic
985508298 5:297633-297655 TGTGTTCTCACCACGGGCACAGG - Intronic
985739742 5:1608037-1608059 TGTGTTCTCACCACGGGCACAGG + Intergenic
987897470 5:23965984-23966006 GGTGTTCTCACGAGGAGCTTGGG - Intronic
989657318 5:43758999-43759021 GGTGTGCCAATCACGAGGTCAGG - Intergenic
993160339 5:84282098-84282120 GGTGGACAAATCACGAGCTCAGG - Intronic
1001140533 5:169140160-169140182 GGTGTGCTCACAAAGAGCTCCGG + Intronic
1003143878 6:3493615-3493637 GGTGTCCTAACCACGAGAAGGGG + Intergenic
1005835834 6:29708845-29708867 GATGTTCTAACCACAAGCCCAGG - Intergenic
1011196432 6:84784508-84784530 GATGTTCTAGCCACAAGATCAGG + Intergenic
1012618179 6:101303505-101303527 GATGTTCTAACCACAAGCCCAGG - Intergenic
1014939055 6:127417079-127417101 GGTGGGCGAACCACGAGGTCAGG + Intergenic
1015313677 6:131793282-131793304 GGTGGGCAAACCACGAGGTCAGG - Intergenic
1016678538 6:146800347-146800369 TGTGTTCTCACCACAAACTCCGG - Intronic
1020715842 7:11674091-11674113 GGTGTTCTAACCCTGAGGTAGGG + Intronic
1023249210 7:38239424-38239446 GGTGTGATAACCACGATCTCAGG + Intergenic
1023250856 7:38259488-38259510 GGTGTGATAACCACGATCTCAGG + Intergenic
1024954513 7:54902572-54902594 GGTTTTCTAACAAGGAGCTGTGG + Intergenic
1028494311 7:91447297-91447319 GGTGTTCAGATCACGAGGTCAGG + Intergenic
1039329281 8:36519243-36519265 GATGTTCTAACCACCAGCCCAGG + Intergenic
1039814302 8:41079311-41079333 GATCTTCTAACCAGGAGCCCAGG + Intergenic
1040936082 8:52783513-52783535 GATGTTCTAACCATGAGCCCAGG + Intergenic
1044388695 8:91622650-91622672 GATGTTCTAACCCTGAGCTCTGG - Intergenic
1055279088 9:74653655-74653677 GGTGTTATTACCAAGAGCACCGG - Intronic
1057808893 9:98242210-98242232 GGTGGGCAAACCACGAGGTCAGG + Intronic
1060664242 9:125423438-125423460 GGTTTTATAACCACGGGCACAGG + Intergenic
1060931893 9:127494347-127494369 GTTGTTCTGAGCACGGGCTCTGG + Intronic
1192622508 X:72693478-72693500 ACTGTTCTCACCACTAGCTCTGG - Intronic
1193278742 X:79623613-79623635 TATGTTCTAACCATGAGCTCAGG + Intergenic