ID: 947935616

View in Genome Browser
Species Human (GRCh38)
Location 2:234001117-234001139
Sequence TCCTCATCTCCAAAGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 2, 2: 9, 3: 79, 4: 358}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947935616_947935618 -6 Left 947935616 2:234001117-234001139 CCCTGTGTCTTTGGAGATGAGGA 0: 1
1: 2
2: 9
3: 79
4: 358
Right 947935618 2:234001134-234001156 TGAGGACACTGTTTTCCCCTAGG 0: 1
1: 0
2: 1
3: 23
4: 224
947935616_947935619 1 Left 947935616 2:234001117-234001139 CCCTGTGTCTTTGGAGATGAGGA 0: 1
1: 2
2: 9
3: 79
4: 358
Right 947935619 2:234001141-234001163 ACTGTTTTCCCCTAGGTATAAGG 0: 1
1: 0
2: 1
3: 13
4: 136
947935616_947935623 21 Left 947935616 2:234001117-234001139 CCCTGTGTCTTTGGAGATGAGGA 0: 1
1: 2
2: 9
3: 79
4: 358
Right 947935623 2:234001161-234001183 AGGAGTGTGCCTCTCACATGAGG 0: 1
1: 1
2: 0
3: 19
4: 184
947935616_947935624 22 Left 947935616 2:234001117-234001139 CCCTGTGTCTTTGGAGATGAGGA 0: 1
1: 2
2: 9
3: 79
4: 358
Right 947935624 2:234001162-234001184 GGAGTGTGCCTCTCACATGAGGG 0: 1
1: 0
2: 6
3: 28
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947935616 Original CRISPR TCCTCATCTCCAAAGACACA GGG (reversed) Intronic
900714498 1:4135469-4135491 TCTTCATCTCCAAAGTATCAAGG + Intergenic
900913269 1:5617217-5617239 TCCTCTTCAGCATAGACACAGGG - Intergenic
901466139 1:9422425-9422447 TCTTCATTTCCAAAGATACCTGG + Intergenic
901876429 1:12169406-12169428 TCCACATCTCTAAAGACAAACGG - Intronic
902738354 1:18416266-18416288 TGCTTATCTCCAAAGACACTGGG + Intergenic
903394567 1:22989968-22989990 TCTTCAGCTCCAAAGAGAAAGGG + Intergenic
903467035 1:23558975-23558997 TTGTCATCTCCAACGACAAAAGG - Exonic
904280160 1:29413372-29413394 TCCTCACCTCCAAAGATTCCTGG - Intergenic
904634288 1:31867702-31867724 TCCTCATCTCCAAACCCACGGGG + Intergenic
904798075 1:33072483-33072505 TCCTCAACCACAAGGACACAAGG - Intronic
905364189 1:37439869-37439891 GCCCCATCTCCAAATACACTGGG + Intergenic
907056456 1:51373509-51373531 TCCCCATCTTCAAAGACTCCTGG + Intronic
908218520 1:61979891-61979913 TCCTTATCTCTGAAGACACAGGG - Intronic
908257535 1:62315297-62315319 GTCTGATCTCCAAAGACAGAGGG + Intronic
908341530 1:63185211-63185233 TCTTTATCTCTGAAGACACAAGG - Intergenic
909287180 1:73834638-73834660 TCTCTATCTCCAAAGACAGAGGG + Intergenic
910145156 1:84071520-84071542 TCTTCAGCTCCAAAGAGAAAGGG - Intergenic
910312155 1:85836004-85836026 TCCTCATCTCCAAAAACGAAGGG + Intronic
910370326 1:86508577-86508599 TCTTCTTCTCCAAAGTCACATGG - Intergenic
911983542 1:104595183-104595205 TCCTTATCTCTGAAGACACAGGG + Intergenic
912075245 1:105866343-105866365 TCCTTATCTCTGAACACACAGGG + Intergenic
912988448 1:114458603-114458625 CCCTCATCTCCAAATTCTCAAGG + Intronic
912994738 1:114521584-114521606 TCCTTATCTCTGAAAACACAGGG + Intergenic
914775503 1:150730415-150730437 TCCTTACCTCCAAAAGCACAGGG - Exonic
917867290 1:179209238-179209260 TCCTTATCTCTGAAGACACAGGG + Intronic
919809268 1:201398872-201398894 TCCTCTCCGCCAGAGACACACGG + Intronic
920029272 1:203026815-203026837 TCCTCACCCCCAAGGGCACAGGG - Intronic
920252485 1:204630829-204630851 TACCCATCTCCAAAGCCAGATGG + Intronic
920759268 1:208766372-208766394 ATCCCATCTGCAAAGACACAGGG + Intergenic
921420684 1:214944291-214944313 AAGTCATCTCCAAAGACACAGGG - Intergenic
922945941 1:229514032-229514054 TCTTTATCTCTGAAGACACAGGG + Intergenic
923233538 1:232010832-232010854 TCCTTATCTCTGAAGACACAGGG - Intronic
924214174 1:241803184-241803206 CTCTCATCTCCAAAGAGCCAAGG + Intergenic
924326646 1:242901408-242901430 TCCTTATCTCTGAAGGCACAGGG + Intergenic
924875032 1:248093639-248093661 TCATCATCTCCTAGGACAAAGGG + Intronic
1062772237 10:111679-111701 TCCTCATCTCCATATAGTCATGG + Intergenic
1062946123 10:1463376-1463398 TCCTCTTTGCCAACGACACACGG - Intronic
1063369633 10:5512638-5512660 ACCTCATCTCCAAAGGCGCACGG - Intergenic
1063741109 10:8821225-8821247 TCCAAATGTACAAAGACACACGG + Intergenic
1063757618 10:9032645-9032667 TCCTTATCTCTGAAGACATAGGG + Intergenic
1063851786 10:10200550-10200572 TCCTTATCTCTGAAAACACAGGG + Intergenic
1063937409 10:11092658-11092680 TCCTTATCTCTGAAGAAACAGGG - Intronic
1063961574 10:11310264-11310286 CCCACAGCTCCAAATACACAGGG - Intronic
1064399797 10:15012036-15012058 TCCTCATCTCCAGAGGAAGAGGG + Intergenic
1064580295 10:16786855-16786877 TGCTCATCTGCAAGGACACCTGG + Intronic
1065010969 10:21420386-21420408 TCCTTATCTCTGAAGACACAGGG - Intergenic
1065183292 10:23147998-23148020 AAATGATCTCCAAAGACACACGG - Intergenic
1065286486 10:24192277-24192299 TCCTTGTCTCTGAAGACACAGGG - Intronic
1066038622 10:31521466-31521488 TCCTCATCCAGAAATACACAGGG + Exonic
1066160953 10:32727470-32727492 ACATCATCTCCAAATTCACAGGG + Intronic
1067699275 10:48556971-48556993 TCCTGCGCTCCAAGGACACATGG + Intronic
1068299201 10:55116889-55116911 CCCTAATCTCTGAAGACACATGG + Intronic
1069922160 10:71822298-71822320 TCCACATCTCCAAGGACACCTGG + Intronic
1070609724 10:77925485-77925507 TCCCCAAGACCAAAGACACAGGG + Intronic
1070905781 10:80071910-80071932 TCCTTAGCTCCAAAGAGAAAGGG - Intergenic
1071689226 10:87797922-87797944 TTCTCAGCTCCAAAGAGAAAGGG + Intronic
1071749720 10:88460994-88461016 TCCACCTTTCCACAGACACAGGG - Intronic
1071761157 10:88608932-88608954 TCATCCTCTCCAATTACACAGGG + Intergenic
1072031603 10:91527126-91527148 TCCTCATCTTCAAAGCCACAGGG + Intergenic
1072833005 10:98679154-98679176 CCCTCATTCTCAAAGACACATGG - Intronic
1075689938 10:124387900-124387922 TCCTCACCTCTGAAGACACAGGG + Intergenic
1076066518 10:127452760-127452782 TCCCCATCACCAAAGCCAGAGGG + Intergenic
1080193815 11:29583639-29583661 TTCTCATCATCAAAGACACCAGG + Intergenic
1080396120 11:31891618-31891640 TCTTTATCTCTGAAGACACAGGG - Intronic
1080955374 11:37087876-37087898 TCTTCATCTCCAGAGAGACGGGG - Intergenic
1081211523 11:40340788-40340810 TCCTGATCACTAAAGACAAAGGG + Intronic
1082145139 11:48657878-48657900 TCCTCATCATCAAAGACCAAAGG - Intergenic
1083041877 11:59696291-59696313 TCCGAATGTCCAAAGACAGATGG - Intergenic
1085183346 11:74554681-74554703 TCCTTATCTCTGAAGACAAAGGG + Intronic
1085514997 11:77106713-77106735 GCCCCATCACCATAGACACACGG + Intronic
1085819200 11:79774010-79774032 TTCTCATCTCCATAAACACTTGG + Intergenic
1086536405 11:87852122-87852144 TCCTTGTCTCTAAAGACACACGG - Intergenic
1086953971 11:92916760-92916782 TCCTCACCTCCCCATACACATGG - Intergenic
1087303415 11:96460999-96461021 TTGTCATCTCTAAAGAGACAGGG + Intronic
1087390175 11:97521257-97521279 TCCTCAGCTCCAAAGAGAAAGGG - Intergenic
1087622237 11:100555268-100555290 GCCTCATCTCTGAAGACACAGGG + Intergenic
1087709996 11:101537249-101537271 TCCTGATTCCCAAGGACACAAGG + Intronic
1087900132 11:103631130-103631152 TTCTTATCTCTGAAGACACAAGG + Intergenic
1089118516 11:116114966-116114988 TCCCCATCCCCCAACACACACGG + Intergenic
1089162316 11:116448094-116448116 TCCTTATCTCTGAACACACAGGG + Intergenic
1089664313 11:120008263-120008285 TCCTTATCTCTCAAGACAAAAGG - Intergenic
1089986152 11:122815999-122816021 CCCTCATCTCTGAAGACAGAGGG - Intergenic
1090591525 11:128275183-128275205 GCCTTATCTCTGAAGACACAGGG + Intergenic
1090652507 11:128819781-128819803 TCTGCATCTCAAAAGGCACAAGG - Intergenic
1091056423 11:132423592-132423614 TCCTCATTTCCAGTTACACAGGG - Intronic
1091613154 12:2028950-2028972 TCCTCAGCGCCAAACACAGAAGG - Intronic
1093484038 12:19634422-19634444 TTCTTATTTCCAAAGGCACAGGG + Intronic
1093798914 12:23347880-23347902 TCCTTATCTCAGAAGACACAAGG - Intergenic
1093870951 12:24290213-24290235 TCCTCATATCCAAATCCAGAAGG + Intergenic
1094286558 12:28800854-28800876 TCCTTATCTCCAAAGAGGGAGGG - Intergenic
1095536664 12:43256942-43256964 TCCTTATCTCTGAAGTCACAGGG + Intergenic
1096287155 12:50310137-50310159 TCCTTATCTCTGAAGACAGAGGG - Intergenic
1097713788 12:62943456-62943478 TCCTTATCTCTGGAGACACAGGG + Intergenic
1097713834 12:62944163-62944185 TCCTTATCTCTGAGGACACAAGG - Intergenic
1098087160 12:66858720-66858742 TCCTCTACTCCAAGGAGACATGG + Intergenic
1098868812 12:75792857-75792879 TAATCATATCCAGAGACACAAGG + Intergenic
1099102665 12:78461213-78461235 TCCTCATCTCTGAAGATATAGGG - Intergenic
1100284955 12:93156407-93156429 CACTCATCTCCACAGCCACACGG + Intergenic
1100426410 12:94491038-94491060 TCCTTATCTCTGAAGACACAAGG + Intergenic
1100436500 12:94576174-94576196 ACCGCATCTCAAAAGACACTTGG - Intronic
1100813106 12:98359986-98360008 TCCTCCTCCCCATAGGCACAAGG + Intergenic
1101307785 12:103546870-103546892 TCTTTGTCTCCAAAGACACAGGG + Intergenic
1101345700 12:103884244-103884266 TCTTCATTTCCAAAGAGATATGG + Intergenic
1101920530 12:108928947-108928969 TCCTTATCTCCAAAGACACAGGG + Intronic
1102847540 12:116203064-116203086 TCCTCATCTACAAAAACAGCGGG + Intronic
1102950838 12:117030191-117030213 TATTCATCTCCAACTACACAGGG + Intronic
1104483907 12:129132850-129132872 TCCTCATCTCCATATCCCCATGG - Intronic
1104551455 12:129761167-129761189 TCCTCATCCCCAGAGTCACTTGG + Intronic
1105444391 13:20440056-20440078 TCCTTGTCTCTGAAGACACAGGG + Intronic
1106425720 13:29627023-29627045 ACCTCACGTTCAAAGACACACGG + Intergenic
1106471729 13:30061890-30061912 CCCTTATCTCTGAAGACACATGG + Intergenic
1107993089 13:45835598-45835620 ACCTCAAGTCCAAAGTCACATGG + Intronic
1108196357 13:47999795-47999817 TCCTCATCTACAAAAGCAAAGGG + Intronic
1110065287 13:71096839-71096861 TCCTCATCTTCGAAGCCTCAGGG + Intergenic
1111052389 13:82901765-82901787 TCCTTATGCCCAAAGACAAAAGG - Intergenic
1112531349 13:100206868-100206890 TCCTCATCCCCATAGAGAAAAGG + Intronic
1112730533 13:102355552-102355574 TCCCCATCTCGTATGACACAAGG + Intronic
1113141541 13:107157369-107157391 TCCTAATCAGGAAAGACACAAGG - Intergenic
1114940857 14:27608316-27608338 TCCTCAGCTCCAAAGAGGCAAGG + Intergenic
1115533700 14:34352776-34352798 TTCTCAGCTCCAAAGAGAAAGGG - Intronic
1115814271 14:37146019-37146041 TCCTCACCACCAATGACACTGGG + Intronic
1116636573 14:47403878-47403900 TCCTTATCTCTGAAGATACAGGG + Intronic
1117953545 14:61105517-61105539 TCCTTATCTCTGAAGACACTGGG - Intergenic
1118058859 14:62113798-62113820 TTCACATTTCCAAAGCCACAGGG + Intergenic
1118683038 14:68262758-68262780 TCCTTATCTCTGAAGACACACGG + Intronic
1118705836 14:68479469-68479491 TCCTTATCTCTGAAGACACAGGG + Intronic
1118871538 14:69747036-69747058 TTCTCAGCTCCAAAGAGAAAGGG - Intronic
1119065471 14:71521425-71521447 CCCTTATCTCTGAAGACACAGGG - Intronic
1119138808 14:72245906-72245928 TCTTTCTCTCCAAAGACACAGGG - Intronic
1119727520 14:76930738-76930760 TCCCCATCTTCAAAGAAACCAGG - Intergenic
1120179758 14:81331278-81331300 TCCACATTTCCAAAGACACATGG - Intronic
1120852076 14:89180474-89180496 TCCTCATCTGTAAAGAGACCAGG + Intronic
1120974866 14:90239735-90239757 TCCTCAGCTCCAAAGAGAAAGGG + Intergenic
1122236317 14:100332532-100332554 GCCTCATCCCCAAACACTCATGG + Intergenic
1123903026 15:24895135-24895157 TCTTTATCTCTGAAGACACAGGG - Intronic
1125306101 15:38316795-38316817 TCATCATCTACAAATGCACAGGG - Intronic
1125333181 15:38602095-38602117 CCCTTATCTCTGAAGACACAGGG + Intergenic
1128905918 15:71467532-71467554 TCCTTATCTCTGAAGACACAGGG - Intronic
1129112616 15:73346608-73346630 CCCTCACCTCCAGAGACTCATGG + Intronic
1129337427 15:74861272-74861294 GCCTCATCTCCAAAGCCAATAGG - Intronic
1129663843 15:77568277-77568299 TCCTCATCACCAAGGACATCTGG + Intergenic
1130100099 15:80886851-80886873 TCCTTATCCCCAAACACAGAAGG - Intronic
1131303220 15:91218283-91218305 TCCTTATCTCTGAAGACACAGGG - Intronic
1133761523 16:8802494-8802516 TATTCATCTCCATAGCCACAGGG + Intronic
1133844685 16:9443057-9443079 TCATCATCTGTAAACACACAGGG - Intergenic
1135012497 16:18894440-18894462 TCCTCTTCTTCAAAGGCTCAGGG - Intronic
1135319421 16:21481996-21482018 TCCTCTTCTTCAAAGGCTCAGGG - Intergenic
1135372258 16:21913484-21913506 TCCTCTTCTTCAAAGGCTCAGGG - Intergenic
1135439528 16:22457224-22457246 TCCTCTTCTTCAAAGGCTCAGGG + Intergenic
1135903477 16:26488890-26488912 TCCTCCTCTCCAAATTCAGAGGG + Intergenic
1136278572 16:29193678-29193700 TTCTCGTCTTCACAGACACATGG + Intergenic
1138079308 16:54073544-54073566 TCCTAATCCCAAAATACACATGG - Intronic
1138861097 16:60758592-60758614 TCCTTTTCTCTGAAGACACAGGG + Intergenic
1140238048 16:73176237-73176259 TCCTCATCTGCCAAGTCAGAAGG + Intergenic
1140355884 16:74306056-74306078 TCCTCATCTTGAAAGACTCTTGG + Exonic
1140544951 16:75798687-75798709 TCATCATTTCTAAAGTCACAGGG - Intergenic
1143537207 17:7548763-7548785 TCCTTATCTCTGAAGACACAGGG + Intergenic
1144408036 17:14971869-14971891 TCCTTCTCTCTGAAGACACAGGG - Intergenic
1145097685 17:20045520-20045542 TCCTCATCTCAGATGACATAAGG + Intronic
1146425712 17:32736178-32736200 CCCTGATCTCCATACACACATGG + Intronic
1148252717 17:46098803-46098825 TCATCATCTCCAATGAAAAATGG + Intronic
1149230079 17:54522937-54522959 TCTTTATCTCTGAAGACACAAGG + Intergenic
1151441865 17:74134769-74134791 TCCTTATCTCCGAAGACCCAGGG - Intergenic
1151559937 17:74864666-74864688 GCCTCCTCCCCAAAGGCACAGGG + Intronic
1151708746 17:75787522-75787544 TCCTCTTCTTAAAAGAGACATGG + Intronic
1151854917 17:76714196-76714218 GCCTCATCCCCAAAGACCCAGGG + Exonic
1153101234 18:1471917-1471939 TCCTTATGTCCAAAGACAGAGGG - Intergenic
1153530239 18:6038871-6038893 TCCTCATCTCCAAAAACCGTAGG - Intronic
1156244565 18:35284912-35284934 TCCTGGTCTCCAAGAACACAGGG + Intronic
1156380550 18:36556321-36556343 TCCTCATCTCCAACCAAACTTGG + Intronic
1156870433 18:41939219-41939241 TCCTTATCTCTGAAGACAAAGGG + Intergenic
1157418033 18:47522103-47522125 TCCTAATATCTGAAGACACAAGG + Intergenic
1158167135 18:54553500-54553522 TCCTCAGCTCTAAAGAGAAAGGG - Intergenic
1158197109 18:54900474-54900496 TCCTTATCTTGGAAGACACAGGG - Intergenic
1158199961 18:54929002-54929024 TCCTCATCTTCAAGGAAACCTGG + Intronic
1158283732 18:55855554-55855576 TTGTCATCTCCAAAGACCCATGG + Intergenic
1158350017 18:56555310-56555332 ACCTCATCTCTAAAAACAGAAGG - Intergenic
1158593257 18:58795073-58795095 TCTTCATCTCTGAAGACCCAGGG - Intergenic
1158782144 18:60664016-60664038 CCCTCATCTCCAGGGACACCTGG - Intergenic
1158862092 18:61602627-61602649 TCCTTATCTCTGAAGACACAGGG + Intergenic
1161716756 19:5880594-5880616 TCCTCACCCCCAGTGACACAGGG + Intronic
1162147469 19:8621521-8621543 TCCTCAGCACCAAAGACAGCTGG - Intergenic
1166407708 19:42533102-42533124 TTCTAATGTCCAAAGACAAAAGG - Intronic
1166896949 19:46029267-46029289 TGCTGATGTCCAAAGTCACAGGG + Intergenic
1166968586 19:46546755-46546777 TCCTCTTCTCCTCAGGCACATGG - Intronic
1168305403 19:55432605-55432627 TTCTCTGCTGCAAAGACACAGGG + Exonic
925284592 2:2707456-2707478 TCATCTTCCGCAAAGACACAGGG - Intergenic
926706719 2:15842691-15842713 GCCCACTCTCCAAAGACACAGGG - Intergenic
926839365 2:17061672-17061694 TCCTCAACTCAAAGTACACAGGG - Intergenic
927096800 2:19753541-19753563 TCCTCATCTCCTAGGAAACCAGG + Intergenic
927839612 2:26431326-26431348 TCCCCATCTGCAAGGCCACACGG - Intronic
928397754 2:30955971-30955993 TCATCAGCTGCAAAGACAAAAGG + Exonic
929501741 2:42495839-42495861 TCTTCATCTTCACAGACACGGGG - Intronic
930001765 2:46866464-46866486 TTTTCATCTCCAAAGGCTCAAGG - Intergenic
930101227 2:47605065-47605087 TTCTCATCTCTGAAGACAAAGGG - Intergenic
930494850 2:52128018-52128040 TTCTCAGCTCCAAAGAGAAAGGG + Intergenic
930558399 2:52929265-52929287 GCCTTATCTCCGATGACACACGG - Intergenic
930872279 2:56182521-56182543 TCCTCCTCTCCACAAACACTAGG + Intergenic
931117777 2:59183086-59183108 TCCTCAACTCCTACAACACAGGG + Intergenic
931402517 2:61944027-61944049 TCCTCAGCTCCAAAAAGAAAGGG - Intronic
933941370 2:87247723-87247745 TCTTTATCTCTGAAGACACAGGG + Intergenic
934709750 2:96507131-96507153 TCCTTACCTCTGAAGACACAGGG + Intronic
935331778 2:101982643-101982665 TCCTCATCTACAAATGCAGATGG + Intergenic
935625542 2:105169454-105169476 TCCTTATCTCTGAAGACACAGGG + Intergenic
936338852 2:111613865-111613887 TCTTTATCTCTGAAGACACAGGG - Intergenic
936626422 2:114153983-114154005 TCAGCCTCTCCAAAGACTCAAGG - Intergenic
937551121 2:123093832-123093854 CCCTAACCTCCAAAGAGACATGG - Intergenic
938930857 2:136085702-136085724 TCCTCATTTCCAATGATACTGGG - Intergenic
939259794 2:139792526-139792548 TCTTTATCTCTGAAGACACAGGG - Intergenic
939337803 2:140853236-140853258 TCCTTGTCTCTGAAGACACAGGG + Intronic
939805742 2:146774332-146774354 TCCTCTACTCAAAAGACAGAGGG - Intergenic
940537618 2:154966613-154966635 TCTTCATCTCCCAAGAATCATGG - Intergenic
941803172 2:169683939-169683961 TCCTGATCTCCAAAGATATGGGG - Intronic
944456725 2:199902675-199902697 TCCTTATCTCTGAAGGCACAGGG - Intergenic
944886067 2:204063835-204063857 TCCTTATCTCTGAAGACACAGGG + Intergenic
945011630 2:205470094-205470116 TCCTCACCTACAGACACACAGGG + Intronic
945628479 2:212240343-212240365 TCCTTATCTCTAAAGACGAAGGG + Intronic
945910323 2:215641434-215641456 TTCTCATCTCTAAAAACTCATGG - Intergenic
947628775 2:231638009-231638031 GCCTTATCTCCAAAGAGACAGGG + Intergenic
947935616 2:234001117-234001139 TCCTCATCTCCAAAGACACAGGG - Intronic
1168824800 20:802913-802935 TCCTTAGCTCCAAAGAGAAAGGG + Intergenic
1169016698 20:2298382-2298404 TCCCCATCCCCAAAGCCACTTGG + Intronic
1169244305 20:4014084-4014106 TCCTCATCTCCAGAGAGAGAAGG - Intronic
1169515264 20:6309993-6310015 AACTCATATCCAAAGCCACAGGG - Intergenic
1169573310 20:6930038-6930060 TCCTCATCTCAGATGCCACAAGG + Intergenic
1170341007 20:15327241-15327263 TTCTTATCTCAGAAGACACAAGG - Intronic
1170341272 20:15329975-15329997 TCCTTATCTCTGAAGACACCGGG + Intronic
1172166964 20:32905452-32905474 TCCTTATTTCTGAAGACACAGGG - Intronic
1172981020 20:38941771-38941793 TTTGCATCTCCAAAGACACTTGG - Intronic
1173102852 20:40103642-40103664 TGCTCATTTCCAAATCCACAAGG - Intergenic
1173366778 20:42393092-42393114 TCCTTATCTCTGAAGACACAGGG - Intronic
1173626386 20:44476012-44476034 TCCTCAGCTCCCAGGGCACACGG - Intronic
1174604508 20:51751095-51751117 TCCTCATCTGCAGAGAAAAAGGG - Intronic
1176130149 20:63493394-63493416 TCCTCATCTCAAAGGGCACGAGG - Intronic
1176968265 21:15236265-15236287 TTCTCATCTCTGAAGACACAGGG - Intergenic
1177115623 21:17082665-17082687 TCCTTATATCTGAAGACACAGGG - Intergenic
1177498827 21:21924125-21924147 TCTCCATCTCCATAGCCACATGG - Intergenic
1179457118 21:41507670-41507692 TCCTCCTCCCCAAAGAGAAAAGG + Intronic
1179805188 21:43832795-43832817 GCCTTATCTGCAAAGTCACAGGG - Intergenic
1181325037 22:22038457-22038479 CCCTGATCCCCAAAGGCACAGGG + Intergenic
1181727213 22:24819992-24820014 CCCCCATCTCCACAGACCCAGGG - Intronic
1184771888 22:46602003-46602025 TCCTCGTTTCCATAGACACATGG + Intronic
949341848 3:3038801-3038823 TGCTGATCTCCAGAGACAAAGGG + Intronic
949596708 3:5555338-5555360 TCGTCAGCTTCAAAGACAAAGGG - Intergenic
949957945 3:9285495-9285517 TCCTCATCTCTGAAGACACAGGG + Intronic
950406727 3:12809621-12809643 TCAGCATCTCCAAAGGCACTAGG + Intronic
952162752 3:30710808-30710830 TCCTTATCTCTGAAGACACAGGG - Intergenic
953589421 3:44237335-44237357 TCCTTATCTCTGAAGACACAGGG - Intergenic
953857826 3:46514700-46514722 TCCTTATCCTCAAAGACACAGGG + Intergenic
953928241 3:46993206-46993228 TCCTCATCTGTAAAAACAGAGGG - Intronic
955429063 3:58822942-58822964 TCCTTATCTCTGAAGACACAGGG + Intronic
955567071 3:60258870-60258892 TCCTTATCTCTGAAGATACAGGG - Intronic
955637879 3:61049906-61049928 TCCTTACCTCTGAAGACACAGGG + Intronic
955906951 3:63817081-63817103 TCCACATTTTCAAAGACACTGGG + Intergenic
956436264 3:69237273-69237295 TCCTCCCCTCCTAAGCCACAGGG + Intronic
956586013 3:70865858-70865880 TCTTTATCTCCAAAGACAAAAGG - Intergenic
956636707 3:71371969-71371991 TCCTCATGTACAAAGAGCCAGGG - Intronic
957179870 3:76862604-76862626 TCCATATCTCTGAAGACACAGGG - Intronic
957274501 3:78073580-78073602 TTCTTATCTCCAAAGACACAGGG + Intergenic
957292731 3:78297597-78297619 TCCTTATTTCTGAAGACACAGGG - Intergenic
957315665 3:78572972-78572994 TTCTCATCTTGGAAGACACAGGG - Intergenic
957450885 3:80380509-80380531 AACTCATCTCCAGAGACAGAGGG - Intergenic
957758933 3:84530470-84530492 GCCTCATCTTAAAAGACACTAGG + Intergenic
958266295 3:91441368-91441390 TCCTTATCACTGAAGACACAGGG + Intergenic
959645188 3:108691527-108691549 TCCTTATCTCTGGAGACACAGGG - Intronic
959739090 3:109695324-109695346 TCCTCAGCTCCAAGCTCACAGGG + Intergenic
960079030 3:113521256-113521278 TCCTCATCCTCAATGACACTTGG - Intergenic
960285488 3:115823802-115823824 TCCTAATTTCCAAAGCAACATGG + Intronic
960461561 3:117942229-117942251 TCTTCATCTGAAAGGACACAGGG + Intergenic
960810508 3:121623220-121623242 TCCTCATCAGCACAGACACCTGG - Exonic
961831458 3:129625181-129625203 ACCCCATCTCCCAAAACACAGGG + Intergenic
962761474 3:138518685-138518707 TCATCATCATCAAAGACAAAAGG + Intronic
963209224 3:142670266-142670288 TCACCATCTCTAAAGCCACAGGG - Intronic
963232960 3:142927377-142927399 TTCTAGTCTCCAAAGTCACAAGG - Intergenic
964238003 3:154557008-154557030 TCCTTATCTCTGAAGACACAGGG - Intergenic
964779408 3:160318941-160318963 TCCTTATTTCTGAAGACACAGGG + Intronic
964780283 3:160329582-160329604 TCCTTATCTCTAAAGACACAGGG + Intronic
965090536 3:164157116-164157138 TCCTTATGTCTAAAGACAGAAGG + Intergenic
965405453 3:168262760-168262782 TGCTCATCTCCATACATACAGGG - Intergenic
966319596 3:178686441-178686463 TCTTTACCTCTAAAGACACAGGG - Intronic
966928347 3:184659934-184659956 TCCTCATCTGCCCAGACCCAAGG + Intronic
967163132 3:186757097-186757119 TCCCCATGTCCAAAGGCACATGG + Intergenic
967507667 3:190271390-190271412 TTCTTATCTCTGAAGACACAGGG - Intergenic
967790142 3:193539641-193539663 ACCCCATCTCCAAAGGCTCAGGG - Intronic
968059827 3:195719081-195719103 TTCTCAGCTCCAAAGAGAAAGGG + Intergenic
968083083 3:195860332-195860354 TCCTCTGCTCCCAAGACACCTGG + Intergenic
970910964 4:21275159-21275181 TCTTCATCTCTAAAGATAAAAGG - Intronic
972364001 4:38356329-38356351 ACCTTGTCTCCAAAGGCACATGG + Intergenic
972429426 4:38966244-38966266 TCCCTATCTCCCAAGACACAGGG - Intergenic
972793634 4:42396447-42396469 TTCTCAGCTCCAGCGACACAAGG - Intergenic
974231381 4:59119646-59119668 GCTTTATCTCCAAAGACAGAAGG - Intergenic
975820066 4:78261632-78261654 CCCTTATCTCCGAAGACACAGGG + Intronic
976575334 4:86663444-86663466 TCCTCATCTCTGAAGACACAGGG - Intronic
976885089 4:89972137-89972159 TCATCATGTGCAAAGAAACATGG + Intergenic
977229899 4:94439440-94439462 TCCTTATCTCTGAAGACACAGGG + Intergenic
977382493 4:96293997-96294019 TCGTCATCTACAAGGACAGATGG + Intergenic
978808556 4:112825880-112825902 TTCTTATCTCCAAAGGCACAGGG - Intronic
979143799 4:117214687-117214709 TCCTTATCTCCAAAAAAAGAAGG - Intergenic
979456434 4:120930695-120930717 TCCTTATCTCTGAAGACACATGG - Intergenic
979460897 4:120982139-120982161 TCCTCGTCTCCAACGACAGAGGG - Intergenic
979623758 4:122824824-122824846 TCCTTATCTCTGAAGACACACGG + Intergenic
981868433 4:149456273-149456295 TCCCTATCTCTGAAGACACAAGG - Intergenic
982445239 4:155483373-155483395 TCCTTATCTCCAAAGATGAAGGG - Intergenic
982612422 4:157592743-157592765 TCCTTATCTCTGAAGACCCAGGG - Intergenic
983583670 4:169333842-169333864 TCCTTCTCTCCCAATACACATGG - Intergenic
983711836 4:170726776-170726798 TCCTCATCTCCAAATATTCCTGG - Intergenic
984231692 4:177108363-177108385 TGCTTATCTCCAGAGGCACATGG - Intergenic
985101990 4:186467477-186467499 TTCTTATCTCCAAAGACAGAGGG - Intronic
985314531 4:188642498-188642520 TCCTTATCTCTGAAGACACAAGG - Intergenic
985429761 4:189867917-189867939 TCCTTATCTCTGAAGACACAGGG - Intergenic
985709896 5:1422297-1422319 TCCTTTTCTTCAAAGACCCAAGG - Intronic
986446894 5:7829297-7829319 TCCTCACCTGCAAAAACACTGGG - Exonic
987985905 5:25145227-25145249 TCCACATCACTAAAGAAACAAGG + Intergenic
987987067 5:25161386-25161408 TTCTCAGCTCCAAAGAGAAAGGG - Intergenic
988061856 5:26180811-26180833 TTCTCATCTCCAGAGCTACAAGG + Intergenic
989734411 5:44686764-44686786 CACTCATCTCCAAATCCACAGGG - Intergenic
993971228 5:94422283-94422305 TCCTCCTCTCTGAAAACACAGGG + Intronic
994041645 5:95265660-95265682 TATTTATCTCCCAAGACACAGGG + Intronic
994248609 5:97510492-97510514 TCCTTATCTCTGAAGACAGATGG + Intergenic
996465979 5:123803135-123803157 TCCTTATCTCTGAAGACACAGGG + Intergenic
996558550 5:124803811-124803833 TCCTTATCTCTGAAGACACAGGG - Intergenic
996576846 5:124984930-124984952 TCCATATCTCCAAAGACACAGGG + Intergenic
997792185 5:136770941-136770963 TCCTCTTCTCCACAGATAGACGG - Intergenic
998793023 5:145786503-145786525 GCTTCATCTCCAAACTCACATGG - Intronic
1000643329 5:163731652-163731674 CCCTCATAACAAAAGACACAAGG - Intergenic
1000861059 5:166456599-166456621 ACTTCATCACCAAAGACTCATGG - Intergenic
1001829638 5:174774609-174774631 GCCTCAATTCCAAAGACAGAAGG - Intergenic
1002865870 6:1121925-1121947 ACCACATCTCCAAATACGCACGG + Intergenic
1003750196 6:9047066-9047088 TCCCCACCTCCAAAGAAAGAAGG - Intergenic
1004290803 6:14365198-14365220 TCCTTAACTCTGAAGACACAAGG - Intergenic
1005030086 6:21500445-21500467 TCTTGATCTCCAAGGACAAAAGG - Intergenic
1005103579 6:22199540-22199562 TCCTTATGTCTGAAGACACAGGG + Intergenic
1005302495 6:24484217-24484239 GCCTCATCTCAAAAAACAAATGG - Intronic
1006337273 6:33427388-33427410 ACCTCAACTCCAAACACACACGG - Intronic
1007044989 6:38764132-38764154 ACCTCATCTACAAAAACACTAGG + Intronic
1007540827 6:42642600-42642622 TCCTCAGCTCCAAACTCATATGG + Intronic
1008193181 6:48485216-48485238 TCCTCATGTCCACACAAACATGG + Intergenic
1008988981 6:57580608-57580630 TCCTTATCGCTGAAGACACAGGG - Intronic
1009177523 6:60478846-60478868 TCCTTATCACTGAAGACACAGGG - Intergenic
1009840121 6:69060430-69060452 TCCACATTCCCAAACACACAGGG + Intronic
1010767834 6:79796378-79796400 TTCTTATCTCAAAAGACAAAGGG + Intergenic
1011745599 6:90404964-90404986 ACCTCATCTCTGAAGACACAGGG + Intergenic
1012726277 6:102814926-102814948 TCCTTATCACTGAAGACACAGGG - Intergenic
1013067832 6:106700600-106700622 TCCTTATTTCTGAAGACACAGGG + Intergenic
1013068197 6:106703993-106704015 TCCTTATCTCTGAAGACCCAGGG + Intergenic
1013105492 6:107023538-107023560 TCCTTATTTCTGAAGACACACGG - Intergenic
1014044096 6:116863915-116863937 TCATGATGTCCAAAGACACCTGG - Intergenic
1014554734 6:122831717-122831739 TCCTTATCTCTGAAGGCACAGGG + Intergenic
1014772823 6:125476300-125476322 TCCTTATCTCTGAAGACACAAGG - Intergenic
1015416136 6:132950766-132950788 TCCTTGCCTCCAAAGCCACAGGG + Intergenic
1015632486 6:135245651-135245673 TCCTTGTCTCTGAAGACACAAGG + Intergenic
1015705183 6:136080153-136080175 TCCTGTTCTCTAGAGACACAGGG - Intronic
1015961085 6:138650057-138650079 TCCACATCTGGATAGACACATGG + Intronic
1017638940 6:156471656-156471678 CCCTCATCTCCAAGGCCACATGG + Intergenic
1017875040 6:158517178-158517200 TCTCCATCTCTGAAGACACAGGG + Intergenic
1018437066 6:163771229-163771251 TCCTCCTCTCTAGAGACAGAGGG - Intergenic
1018940966 6:168308651-168308673 TCCCCATCTCCACAGAGGCAGGG - Exonic
1019041884 6:169112774-169112796 TCCTCAGCTTCAAAGAGAAAGGG + Intergenic
1020771478 7:12400964-12400986 TGTTCATCTCAACAGACACAGGG + Intronic
1022316360 7:29248834-29248856 GGCTCATCTCCAGAGTCACATGG - Intronic
1022521935 7:31014064-31014086 TGCTCATGCCCAAATACACAAGG + Intergenic
1023137206 7:37064501-37064523 TCCTCATCTATGAAGACACAAGG + Intronic
1024791081 7:52965363-52965385 TCTTTATCTCTGAAGACACAGGG + Intergenic
1026175019 7:67988954-67988976 TCAATATTTCCAAAGACACAGGG - Intergenic
1026978637 7:74514001-74514023 TCCCCATCTCAAAAGAACCATGG + Intronic
1027395980 7:77754796-77754818 TCTTCATTTTCAAAGAGACATGG - Intronic
1027469418 7:78554694-78554716 TCCTTATCTCTGAAGACACAGGG + Intronic
1027530702 7:79328316-79328338 TCCTCCTGTCCAAAGACCCATGG + Intronic
1027717502 7:81691336-81691358 TCCTCATCTCTAAATACACCTGG - Intergenic
1027752010 7:82161182-82161204 TCCTCATCTCTGAAGATACAGGG - Intronic
1028212330 7:88089816-88089838 TCCCCATCTCCACAGAGCCAAGG - Intronic
1028903699 7:96129726-96129748 TTCTTATCTCCAAATACAGATGG + Intronic
1031262721 7:119542667-119542689 TCCTTATCTCCAAAAACATGTGG - Intergenic
1031622902 7:123957029-123957051 TTCTCAACTCCACAGAGACAAGG - Intronic
1031639882 7:124149304-124149326 TCTTTAACTCCAAAGAAACAAGG + Intergenic
1031822022 7:126514124-126514146 TGCTCATCTCCATAGGCACTGGG - Intronic
1032313334 7:130809624-130809646 TCCTCACCTCCTTAGACACTTGG - Intergenic
1033066877 7:138164454-138164476 TCCTCATTTCTGAAGATACAAGG + Intergenic
1034854770 7:154532991-154533013 TCCTTATTTCACAAGACACAGGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035301345 7:157899498-157899520 TTTTCATCTCCAAAGTGACAAGG - Intronic
1036460553 8:8948683-8948705 TCCTAACCTCCGACGACACAGGG + Intergenic
1036704868 8:11039496-11039518 TCCTCATCTCGGAAGAGAAAAGG - Intronic
1039235383 8:35497230-35497252 TCCTAATCTCTGAAGACACAGGG - Intronic
1040988690 8:53325447-53325469 TCCTCCTCTCCAAATTCAGAAGG - Intergenic
1041587732 8:59541672-59541694 TCCTTATCTCTAAAGACTCAGGG - Intergenic
1041975369 8:63793597-63793619 TCCTCATCCCGGAAGACACAGGG + Intergenic
1042357041 8:67839716-67839738 TCCTCATCTCTGAAGACATAAGG - Intergenic
1042420332 8:68581306-68581328 TCTTTATTTCTAAAGACACATGG - Intronic
1042938338 8:74082863-74082885 TCCTTACCTCTGAAGACACAGGG - Intergenic
1043247176 8:78019058-78019080 TCCTCAACTCCACACACTCATGG + Intergenic
1044799201 8:95936155-95936177 TCCATGTCTCCCAAGACACAGGG - Intergenic
1047868826 8:129059874-129059896 TCCTCATCTATAAAGATAGAAGG + Intergenic
1048207260 8:132425049-132425071 TCCTGATTTCCAAAGGCACTGGG - Intronic
1048270356 8:133023269-133023291 TCCTCATCTACATAGACATCTGG - Intronic
1048283248 8:133120990-133121012 TCCTCATGTCCCTAGAGACAGGG + Intronic
1048610753 8:136020366-136020388 TTCTCATCTCCAAAAGCATATGG - Intergenic
1048757752 8:137756800-137756822 ACCACATCTCTAAACACACACGG + Intergenic
1048957112 8:139546374-139546396 TCCTCCTCTTCAGAGACAGACGG + Intergenic
1049264531 8:141660393-141660415 CCCTCATCTCCAAAACCTCAGGG - Intergenic
1049352649 8:142172257-142172279 GCCTCATCCTCACAGACACAGGG - Intergenic
1049587109 8:143437287-143437309 TCCTCACCTCCAAAGAAATGGGG - Intergenic
1049925420 9:402407-402429 TCCTCATCTGCAAAAAAACTAGG + Intronic
1050355154 9:4775672-4775694 TGCTCATCACCAAAGACAGCAGG - Intergenic
1050814935 9:9798473-9798495 TCCTTATGTCTGAAGACACAAGG - Intronic
1051774326 9:20619044-20619066 TCCTCTGCTCTACAGACACATGG + Intronic
1052401461 9:28005505-28005527 TCCACATATCCTAAGACACTTGG + Intronic
1053538781 9:38952032-38952054 TCCTTATCTCCGAAGACACAGGG - Intergenic
1054627359 9:67411887-67411909 TCCTTATCTCCGAAGACACAGGG + Intergenic
1054755923 9:68957692-68957714 TACTTATCTCTGAAGACACAGGG - Intronic
1055080616 9:72264961-72264983 TCCTTATCTCTGAAGACACAGGG - Intergenic
1055620377 9:78119424-78119446 GGCTCACCTCCAAATACACAGGG - Intergenic
1055668273 9:78573828-78573850 TCTTCATTTCTAAAGGCACATGG - Intergenic
1057013135 9:91625232-91625254 TGCCCATCTCAATAGACACAGGG - Intronic
1057023866 9:91721400-91721422 TCCTTATCTCTGAAGATACAGGG + Intronic
1057151264 9:92798071-92798093 TCATTATCTACAAAGAAACATGG + Intergenic
1057910091 9:99013362-99013384 TCCTCAGCTTCAAAGAGAAAGGG - Intronic
1058148143 9:101434222-101434244 TCCTCATCTCTAAAGTGACAGGG - Intronic
1058253035 9:102725884-102725906 TCATCATCTCCAAATACAATAGG - Intergenic
1058392586 9:104512657-104512679 TCCATATCACCAAAGAAACATGG + Intergenic
1059316820 9:113432914-113432936 TCCTTAGCTCTGAAGACACAAGG - Intergenic
1061671240 9:132189488-132189510 TTCTCATCTCCAAAGATGCAGGG - Intronic
1062725498 9:138071158-138071180 TTCTCATCCACAAAGAAACACGG - Intronic
1186090867 X:6047798-6047820 TCCTCACCACCTTAGACACAGGG - Intronic
1186655288 X:11605425-11605447 GCCCCATCTCCAAAGCCACTTGG - Intronic
1187138912 X:16574872-16574894 TTCTTATCTCTGAAGACACAGGG + Intergenic
1188338650 X:28971794-28971816 CCCTCATCCCCAAATACAGATGG - Intronic
1188401425 X:29749880-29749902 TTCTAATCTCCAAAGCCACTAGG + Intronic
1189634623 X:42992905-42992927 TCCTTATCTCCAAAGACACAGGG + Intergenic
1191740145 X:64427751-64427773 TCCTCAGCTCCAAAGAGAAAGGG + Intergenic
1192248716 X:69393422-69393444 TCCTCATCTGGAAAGAGAGATGG + Intergenic
1193462543 X:81808179-81808201 TCATCAACTCCAAAGTCACAAGG - Intergenic
1194736263 X:97515681-97515703 TCCTTATCTCTGAAGATACAAGG - Intronic
1195347397 X:103963746-103963768 TCCCCATCTCCCAAGAAAAATGG + Exonic
1195360045 X:104075095-104075117 TCCCCATCTCCCAAGAAAAATGG - Intergenic
1197042719 X:121958837-121958859 TTCTCATCTCCGAAGAGAAAGGG + Intergenic
1197721023 X:129744702-129744724 TCCTCTTCTGCAAAGAGAAATGG + Intronic
1199166322 X:144679722-144679744 TCCTCAGCTCCAAAGAGAAAGGG + Intergenic
1199171548 X:144739896-144739918 TCCTCACCTCCAAAGAGAAGGGG + Intergenic
1199356347 X:146867523-146867545 TCCTCAGCTCCAAAGAGAAAGGG - Intergenic
1199456016 X:148029931-148029953 TCCTTACTTCCACAGACACAGGG + Intergenic
1199864199 X:151828373-151828395 TCATAAACTCCAAATACACATGG - Intergenic
1200164481 X:154026722-154026744 TTCCCATATCAAAAGACACAGGG - Intronic
1200285625 X:154819616-154819638 TCCTCAACCCCAAAGAGAAAGGG - Intronic
1200707921 Y:6458550-6458572 TCCTTCTCTGCCAAGACACAGGG + Intergenic
1200762774 Y:7055127-7055149 TCTTCATCTCCATTTACACATGG - Intronic
1200914587 Y:8560284-8560306 TCCTTTTCTCCCAAGCCACAGGG - Intergenic
1201026191 Y:9706158-9706180 TCCTTCTCTGCCAAGACACAGGG - Intergenic
1201224075 Y:11799975-11799997 TCCTTATCTCTGAAGGCACAGGG + Intergenic