ID: 947941721

View in Genome Browser
Species Human (GRCh38)
Location 2:234062270-234062292
Sequence CCTTCCAGCCAAGAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947941715_947941721 -9 Left 947941715 2:234062256-234062278 CCCCCAGGAACTGACCTTCCAGC 0: 1
1: 0
2: 2
3: 36
4: 243
Right 947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 166
947941713_947941721 10 Left 947941713 2:234062237-234062259 CCTGGGGAGCAGACAGCTTCCCC 0: 1
1: 0
2: 2
3: 18
4: 273
Right 947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 166
947941716_947941721 -10 Left 947941716 2:234062257-234062279 CCCCAGGAACTGACCTTCCAGCC 0: 1
1: 0
2: 3
3: 48
4: 311
Right 947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947941721 Original CRISPR CCTTCCAGCCAAGAACTGGA AGG Intronic
901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG + Intronic
905002816 1:34686529-34686551 CCTTGGAGACCAGAACTGGAGGG + Intergenic
905446567 1:38031467-38031489 CCCTCCAGCCCAGGACTGGTTGG - Intergenic
909202620 1:72710432-72710454 CCTTCCTGCCAATATCTGCATGG + Intergenic
910738752 1:90492453-90492475 CATTCCATCCAACAACTGCAGGG - Intergenic
911448224 1:98027324-98027346 CCTTCCAGATAATATCTGGATGG - Intergenic
913535398 1:119767355-119767377 TCTGCCAGTGAAGAACTGGAGGG + Intronic
915117514 1:153609952-153609974 CCTCCCAGCCAAGGACCAGAGGG - Intronic
915728174 1:158033474-158033496 CCATCCAGCCCAGAACTGCAAGG - Intronic
916187775 1:162149328-162149350 CCTTCCAGTCAAGAGTGGGAGGG + Intronic
916701634 1:167301715-167301737 CCTCCCAACCAGGAACTGTAAGG - Intronic
918451820 1:184665980-184666002 AGTTTCAGCCAAGAGCTGGAAGG - Intergenic
919479121 1:198064647-198064669 CTTTCCAGCCAAAGGCTGGAGGG - Intergenic
922216316 1:223522977-223522999 CCTTGCAGCCAAGAAGGGAAGGG + Intergenic
923226325 1:231941881-231941903 GCAGCCAGCCAAGAACTGTAGGG + Intronic
1063845487 10:10122898-10122920 GCTTCCAGACAATAACTGGGAGG + Intergenic
1065367546 10:24951155-24951177 CCTTTGAGCCAAGATCTGAAGGG - Intronic
1066990302 10:42506802-42506824 CCTTAATGCCAAGAACTGGAGGG - Intergenic
1067981318 10:51088763-51088785 CCTTGGAGCCCAGAAATGGATGG + Intronic
1069903345 10:71718408-71718430 CTTTCCAGCCAGGCACTGGGAGG - Intronic
1073501883 10:103947104-103947126 ACCTCCTGCCTAGAACTGGAGGG - Intergenic
1074542262 10:114374718-114374740 GCTTCCAACTAAGAGCTGGAAGG + Intronic
1075878990 10:125833764-125833786 CCTTGCAGGAAAGAACTGGCGGG + Exonic
1076053506 10:127353101-127353123 CCTTCCAGCCAAGCAGGGGTTGG - Intronic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077936301 11:6790757-6790779 GCTTTCAGCCTAGAACAGGAAGG + Intergenic
1078617725 11:12880997-12881019 CATTCCCGGCCAGAACTGGAAGG - Exonic
1078940663 11:16001577-16001599 TGTTCCAGCCAAGAAATGGTGGG - Intronic
1079225792 11:18603678-18603700 CCTCCCAGGCAAGGACTGGCAGG - Intergenic
1080311874 11:30904078-30904100 CCTTCAAACCAAGAACTGACAGG + Intronic
1081010034 11:37799375-37799397 CCTTCATGCAGAGAACTGGAAGG - Intergenic
1084533200 11:69741429-69741451 CCTTCCAGGGAACATCTGGAGGG + Intergenic
1084564077 11:69919828-69919850 CACTCCAGGCAAGAGCTGGATGG - Intergenic
1085769564 11:79312718-79312740 CCTTCCAACCAAGAAGTGTTGGG - Intronic
1088401182 11:109423554-109423576 CCTACCAGCCAAGAAGAGGACGG - Exonic
1090889027 11:130906430-130906452 CCTGCCAACCCAGAACTGGTAGG + Intronic
1090992092 11:131826962-131826984 ACCTCCAGCCATGAACTAGAGGG - Intronic
1092807552 12:12239118-12239140 CCTTGAATCCTAGAACTGGAAGG - Intronic
1093645132 12:21577403-21577425 CGTTGCAGCCAAGAACTGACTGG - Intronic
1095524681 12:43110931-43110953 TCTTCTAGCCAAGAACTGTGGGG + Intergenic
1096030549 12:48410233-48410255 CCACCCAGCCAAGCACAGGAGGG + Intergenic
1096226220 12:49868428-49868450 TCTTCCAGACAAGAGCTGGGAGG - Exonic
1098022313 12:66169383-66169405 GCTTCCAGCCTAGCACAGGACGG + Intronic
1099594950 12:84649485-84649507 CCTTTCAGCCAAAAACTGCCAGG - Intergenic
1099688014 12:85913910-85913932 CCTTCCAGCCATCACCTGAAAGG - Intergenic
1100163261 12:91886526-91886548 CCTTGCACCCAAGGACTGGTTGG - Intergenic
1100317712 12:93460821-93460843 CCTGACAGCCAAAAACTGGCTGG - Intergenic
1100667150 12:96767582-96767604 CCTGCCAGGAAAGGACTGGAAGG - Intronic
1102765806 12:115431942-115431964 TTTTCCAGCCAAGAATAGGATGG - Intergenic
1103195107 12:119037132-119037154 CCACCCACCCAAGAACTGGGGGG - Intronic
1106052414 13:26204018-26204040 CCTTCCAGAGAAGAAAGGGAAGG - Intronic
1107181547 13:37467056-37467078 CCTCCCAGCCAATAACTGCATGG + Intergenic
1107461428 13:40607215-40607237 TCTTCCAGACAAAAACCGGAGGG + Intronic
1108447857 13:50527240-50527262 CCTTCCTGCACAGAACAGGAGGG - Intronic
1110843213 13:80166253-80166275 GCTTCCTGCCAAAAAGTGGAGGG - Intergenic
1114269089 14:21090597-21090619 CCTTCCTGCGAAGGACTGGGAGG + Exonic
1114452474 14:22836447-22836469 AATTACAACCAAGAACTGGAAGG - Intergenic
1115480661 14:33858002-33858024 CCTTCCTGCCAAGATCTGGAGGG - Intergenic
1119480885 14:74956883-74956905 CATTCCAGCCAAGAGCAGGGAGG + Intergenic
1121472441 14:94165892-94165914 GCCTCCAGCCAGGAAGTGGATGG - Intronic
1122384602 14:101335331-101335353 TCTTCCAGGAAAGAACTGGGCGG + Intergenic
1127275394 15:57439006-57439028 CCTTCCTGCCAGGAACTGGACGG + Exonic
1128444409 15:67744485-67744507 TCTTCCAGACAAGAGCTGCAGGG + Intronic
1128495816 15:68197940-68197962 CCCTCCTGCCCTGAACTGGAGGG + Intronic
1128546090 15:68568821-68568843 CCTGCCAGCCAGGAAGGGGAAGG + Intergenic
1130333694 15:82941063-82941085 CACTCCAGGCAAGAACTGAAGGG - Intronic
1131505298 15:93012812-93012834 CCTTCCATACAAAAGCTGGAAGG - Intronic
1131572609 15:93554231-93554253 CCTTCCAGTGAAGACTTGGATGG + Intergenic
1134095288 16:11414811-11414833 CCTGGCAGCCAAGGACTGGGAGG - Intronic
1134827277 16:17294747-17294769 CCTTCTTGCCCAGAGCTGGAGGG - Intronic
1136097014 16:27963929-27963951 ACTGACCGCCAAGAACTGGAAGG + Intronic
1136097488 16:27967598-27967620 GCTGACAGCCAAGAACTAGAAGG + Intronic
1136742381 16:32548350-32548372 ACATCCAGACAAAAACTGGAAGG + Intergenic
1137888316 16:52130321-52130343 GTTTCCAGCCAAGACTTGGAAGG + Intergenic
1141886739 16:86897440-86897462 GCTTCCAGCATAGAACTGGCCGG - Intergenic
1203027218 16_KI270728v1_random:526878-526900 ACATCCAGACAAAAACTGGAAGG - Intergenic
1203044503 16_KI270728v1_random:807553-807575 ACATCCAGACAAAAACTGGAAGG + Intergenic
1143557382 17:7670338-7670360 ACTCCCAGCCCAGAGCTGGAGGG - Intronic
1143682771 17:8489759-8489781 ACTTACTGCCATGAACTGGAAGG + Intronic
1146950071 17:36899747-36899769 GCCTCCAGCCAAGGCCTGGAGGG + Intergenic
1147792886 17:43024600-43024622 TCCTCCAGCCAAGCACTGGGTGG - Intronic
1148490862 17:48023513-48023535 CCTGCCAGCCAATAGCCGGAAGG + Intergenic
1148643091 17:49202819-49202841 CCTGCCACCAGAGAACTGGATGG - Intronic
1150574457 17:66417459-66417481 CCTTGCAGCCTAGGAATGGATGG - Intronic
1151999517 17:77636722-77636744 GCTTCAAGCCAGAAACTGGAAGG - Intergenic
1152544218 17:80992498-80992520 CCATCCAGGCCAGGACTGGAAGG + Intronic
1153502341 18:5762228-5762250 CCTTACATACAAGAACTGAAGGG - Intergenic
1155186110 18:23387970-23387992 CTTTCAAGCCAAGAATTGGAAGG - Intronic
1157148503 18:45190856-45190878 CCTCACAGCTAAGAACTGCAGGG + Intergenic
1157445423 18:47743027-47743049 TCTTCCAAAGAAGAACTGGAAGG + Intergenic
1157607425 18:48934551-48934573 GCTTCCAGCCAAGAGCTGCTTGG + Intronic
1158416908 18:57256825-57256847 CCTTCCAGCCACGATGAGGATGG + Intergenic
1160942160 19:1625447-1625469 ACGTCCAGCCAGGACCTGGAAGG + Intronic
1161076372 19:2287852-2287874 CCTTCCCGCAAAGTCCTGGAGGG + Intronic
1161320203 19:3637599-3637621 CCTCCCATCCGTGAACTGGACGG + Intronic
1161683505 19:5692157-5692179 CCTGCCAGCCGAGAACAAGAAGG - Exonic
1163636949 19:18441397-18441419 CCTGCCAGCCAAGGACAAGAAGG - Intergenic
925293612 2:2763999-2764021 CCTTTCAGGCAAGAATGGGAAGG - Intergenic
930089133 2:47519221-47519243 CCTTCCTGCCATGAACTAGAAGG + Exonic
932463373 2:71897554-71897576 CCTTCCACCCAAAAACTGTCGGG + Intergenic
937212765 2:120287186-120287208 GCTTCCATCCAAGTCCTGGAAGG - Intronic
945134177 2:206608710-206608732 CCTGCCCACCAAGCACTGGATGG + Intronic
947941721 2:234062270-234062292 CCTTCCAGCCAAGAACTGGAAGG + Intronic
1168812181 20:711293-711315 TCTTCCATCCAAGAACAGCATGG + Intergenic
1169122632 20:3106632-3106654 CCTTCCAATCCAGAACTGGAAGG + Intergenic
1170405141 20:16027918-16027940 CATTCCAGCCAAGCCCTGGAGGG + Intronic
1170643320 20:18175333-18175355 CCTTCCAGCCAATACGTGGCTGG + Intronic
1171334993 20:24376269-24376291 CCATCCAGACATGAACTGGGAGG + Intergenic
1172067777 20:32233778-32233800 GCATCCAGCCCAGAATTGGAAGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1176023577 20:62974761-62974783 CCTTCCAGCCCAGCTCTGGCTGG + Intergenic
1176120312 20:63451626-63451648 CCCTTCAGCCAAGAACAAGAGGG + Intronic
1176183961 20:63767839-63767861 TCTTCCAGCCCAGGCCTGGATGG - Intronic
1180980440 22:19875803-19875825 CCATCCTGCCAACAACAGGAAGG + Exonic
1182756386 22:32683028-32683050 TCTTTCCTCCAAGAACTGGAAGG + Intronic
1183029549 22:35093299-35093321 CATTCCAGCAAATAACAGGAGGG + Intergenic
1183954572 22:41371713-41371735 CCTTCCTTTGAAGAACTGGATGG + Intronic
950132635 3:10557821-10557843 CCATCCTGCTAAGAACAGGAAGG + Intronic
952199399 3:31110938-31110960 TCACCCAGCCAAGAACTTGAAGG + Intergenic
954233035 3:49233453-49233475 CCTTAATGCCAGGAACTGGAGGG + Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
955887048 3:63611547-63611569 CCCAACAGCCAAGAACTGGAAGG + Intronic
958100294 3:88999818-88999840 CCTCCCAGCACAGAAGTGGATGG + Intergenic
960647461 3:119903166-119903188 ACTTCCAGTCAATAAATGGATGG + Intronic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
964743199 3:159988623-159988645 ACCTCCAGCCTAGTACTGGAAGG - Intergenic
966225841 3:177597123-177597145 CATTTCAGACCAGAACTGGATGG + Intergenic
966748727 3:183302380-183302402 CCTCCCAGCCAAGTACTGCACGG - Intronic
969464205 4:7345017-7345039 CCTTCCAGCCAGCAGCAGGAGGG - Intronic
975715745 4:77204122-77204144 CCTTCCATCCAAGCACAAGAAGG - Intronic
978547673 4:109890187-109890209 CCTCCCATCCAAGAACAGCATGG + Intergenic
981545802 4:145892048-145892070 CTTTGCAGCCAAGAACTTAAAGG - Intronic
981889489 4:149718080-149718102 CCCTCCTGCCTACAACTGGAAGG + Intergenic
987163817 5:15173254-15173276 TCTAGCAGGCAAGAACTGGAAGG + Intergenic
992897408 5:81257339-81257361 CCTTCCACCCAAGATGTTGAAGG - Intronic
994248126 5:97504313-97504335 CCTTCCAGCTGAGAAATGGGAGG + Intergenic
994436681 5:99743746-99743768 CCTTCCAACCAAAACGTGGAAGG + Intergenic
997735581 5:136210267-136210289 CCTTCCAGGCTATAACTAGAAGG + Intergenic
999624387 5:153504991-153505013 CGTTCCTGCCAAAAACTAGAGGG - Intronic
999648528 5:153743042-153743064 CCATTCTGCCAAGAACTGGGTGG - Intronic
1001756775 5:174176404-174176426 CCTTTCAGCCAGAAACTGGAAGG - Intronic
1004401350 6:15291635-15291657 CCTTCCAGCCCAGTAGTGGTGGG + Intronic
1004980767 6:21021034-21021056 TCTTCCAAGCAAGAACTGTATGG + Intronic
1006986086 6:38176629-38176651 CTTACCAGTCAACAACTGGAGGG + Intronic
1011004131 6:82624813-82624835 CTTCCCAGCCAGTAACTGGAAGG + Intergenic
1021981047 7:26055913-26055935 CATTCCAGGCCAGAATTGGATGG + Intergenic
1037608248 8:20455432-20455454 TCTTCCAGCCCAGAATTTGATGG - Intergenic
1038527626 8:28290271-28290293 CATTCCAGACAAGAACAAGAAGG + Intergenic
1039361311 8:36880512-36880534 CCTTCATACCAATAACTGGAGGG - Intronic
1041924133 8:63218573-63218595 CCTTCCAGGCAAGATTTGAAAGG + Intergenic
1043593431 8:81856182-81856204 CCTTCCTGACCAGAACAGGAAGG + Intergenic
1044524807 8:93240524-93240546 ACTTCAAGCCAATAACTGGTAGG + Intergenic
1046848146 8:118942019-118942041 CATTCTGGCCCAGAACTGGAAGG + Intronic
1047408017 8:124601417-124601439 CCTTCCAGCCAAGAATGAAAAGG + Intronic
1047529167 8:125659675-125659697 CCTTCCAGGCAGGAACTTTAAGG + Intergenic
1048818380 8:138355601-138355623 CCTTCCAGCCAATGACTGACAGG - Intronic
1048963710 8:139600104-139600126 CTTTCCTAACAAGAACTGGATGG - Intergenic
1049291656 8:141806475-141806497 CCTTGCAGCCACGCCCTGGATGG - Intergenic
1049711948 8:144068781-144068803 CCTTGCAGCCAGGAGCTGGGAGG - Intergenic
1051106874 9:13590412-13590434 CCTTCCAGATAAGAAAGGGAAGG + Intergenic
1051922212 9:22280594-22280616 CCATCCATCCAAGAGCTAGAAGG - Intergenic
1055574194 9:77646344-77646366 CCTCCCTCCCAAGACCTGGATGG - Intronic
1055875238 9:80934256-80934278 CCTCCCTGCCAAGAACTGTTTGG - Intergenic
1055912607 9:81369457-81369479 CCTTCCAGCACAGAACAGCAGGG - Intergenic
1057275984 9:93676190-93676212 CCTCCCAGCTCAGAAATGGAGGG + Intronic
1057293923 9:93824574-93824596 GCTTCCTGCCCAGAAATGGAGGG + Intergenic
1057617280 9:96602989-96603011 GCTTCCAGCCAGCTACTGGATGG + Intronic
1057850058 9:98558539-98558561 CCTGCCAGCCATGAACTTGGGGG - Intronic
1059409342 9:114122351-114122373 CCTTCCAGCCAAGGAATGGCAGG + Intergenic
1059645303 9:116260417-116260439 CCCTCCAGCCAAGAATGGGAAGG - Intronic
1060796379 9:126515137-126515159 CACTCCAGCCAGGGACTGGAGGG - Intergenic
1185615261 X:1418324-1418346 CCTTCCAGCCCAGGGGTGGAGGG + Intronic
1187271102 X:17780465-17780487 CCTTGCACACAAGAACTGGAAGG - Intergenic
1187637798 X:21251470-21251492 TCTTCCTGCCTAGACCTGGAGGG + Intergenic
1190326667 X:49210790-49210812 CTTGCCAGGGAAGAACTGGAGGG + Intronic
1192369741 X:70503524-70503546 CATCCCAGCACAGAACTGGAAGG - Exonic
1194383440 X:93223267-93223289 CCTTCCACAAAAGCACTGGAAGG + Intergenic
1196935269 X:120724296-120724318 CGTTCCAGCCAAGAAATAAAAGG - Intergenic
1200206780 X:154321992-154322014 CCATCCAAAGAAGAACTGGAAGG + Intronic
1201557733 Y:15282191-15282213 CCTTCCACCCAATAACTTTAGGG + Intergenic
1201856696 Y:18552475-18552497 CCTTCCTGGCTAGAAGTGGAAGG - Intronic
1201876625 Y:18767905-18767927 CCTTCCTGGCTAGAAGTGGAAGG + Intronic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic