ID: 947944698

View in Genome Browser
Species Human (GRCh38)
Location 2:234091606-234091628
Sequence GATGCCAATTTTCTGTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947944698_947944701 9 Left 947944698 2:234091606-234091628 CCATTCAACAGAAAATTGGCATC No data
Right 947944701 2:234091638-234091660 CAGATAAAACCTGCCTCAAAAGG No data
947944698_947944702 10 Left 947944698 2:234091606-234091628 CCATTCAACAGAAAATTGGCATC No data
Right 947944702 2:234091639-234091661 AGATAAAACCTGCCTCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947944698 Original CRISPR GATGCCAATTTTCTGTTGAA TGG (reversed) Intergenic
No off target data available for this crispr