ID: 947949509

View in Genome Browser
Species Human (GRCh38)
Location 2:234135245-234135267
Sequence CCCAGGAACCTTTAAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947949509_947949521 21 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949521 2:234135289-234135311 TGCAGTGGGGACTGAGGACGTGG No data
947949509_947949518 7 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949518 2:234135275-234135297 TGGTGATTGCTGGGTGCAGTGGG No data
947949509_947949520 15 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949520 2:234135283-234135305 GCTGGGTGCAGTGGGGACTGAGG No data
947949509_947949522 22 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949522 2:234135290-234135312 GCAGTGGGGACTGAGGACGTGGG No data
947949509_947949517 6 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949517 2:234135274-234135296 CTGGTGATTGCTGGGTGCAGTGG No data
947949509_947949519 8 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949519 2:234135276-234135298 GGTGATTGCTGGGTGCAGTGGGG No data
947949509_947949514 -2 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949514 2:234135266-234135288 GGTGATCCCTGGTGATTGCTGGG No data
947949509_947949513 -3 Left 947949509 2:234135245-234135267 CCATCAGTTTAAAGGTTCCTGGG No data
Right 947949513 2:234135265-234135287 GGGTGATCCCTGGTGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947949509 Original CRISPR CCCAGGAACCTTTAAACTGA TGG (reversed) Intergenic
No off target data available for this crispr