ID: 947951854

View in Genome Browser
Species Human (GRCh38)
Location 2:234154762-234154784
Sequence CAGTGGCCATAGTCTCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947951850_947951854 5 Left 947951850 2:234154734-234154756 CCTACAGCCATTGGATGTATACA No data
Right 947951854 2:234154762-234154784 CAGTGGCCATAGTCTCCACTGGG No data
947951851_947951854 -2 Left 947951851 2:234154741-234154763 CCATTGGATGTATACATTGTACA No data
Right 947951854 2:234154762-234154784 CAGTGGCCATAGTCTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947951854 Original CRISPR CAGTGGCCATAGTCTCCACT GGG Intergenic
No off target data available for this crispr