ID: 947968697

View in Genome Browser
Species Human (GRCh38)
Location 2:234303588-234303610
Sequence ACTCATGGTGTTAAACCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947968694_947968697 14 Left 947968694 2:234303551-234303573 CCTTCAGCAAACATGGACTGAGC No data
Right 947968697 2:234303588-234303610 ACTCATGGTGTTAAACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947968697 Original CRISPR ACTCATGGTGTTAAACCTTC AGG Intergenic
No off target data available for this crispr