ID: 947969019

View in Genome Browser
Species Human (GRCh38)
Location 2:234306433-234306455
Sequence CAGGCAAAAGACTCAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947969014_947969019 17 Left 947969014 2:234306393-234306415 CCTGAATTTCAAGACCTCACACT No data
Right 947969019 2:234306433-234306455 CAGGCAAAAGACTCAGGTGCAGG No data
947969015_947969019 3 Left 947969015 2:234306407-234306429 CCTCACACTTGACACTTCCATGA No data
Right 947969019 2:234306433-234306455 CAGGCAAAAGACTCAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947969019 Original CRISPR CAGGCAAAAGACTCAGGTGC AGG Intergenic
No off target data available for this crispr