ID: 947969197

View in Genome Browser
Species Human (GRCh38)
Location 2:234307836-234307858
Sequence CCTGAGAAGCAGGCAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947969197_947969202 21 Left 947969197 2:234307836-234307858 CCTTTCATTGCCTGCTTCTCAGG No data
Right 947969202 2:234307880-234307902 AATAACACATGTGCCAAGCAAGG No data
947969197_947969203 26 Left 947969197 2:234307836-234307858 CCTTTCATTGCCTGCTTCTCAGG No data
Right 947969203 2:234307885-234307907 CACATGTGCCAAGCAAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947969197 Original CRISPR CCTGAGAAGCAGGCAATGAA AGG (reversed) Intergenic
No off target data available for this crispr