ID: 947971947 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:234332125-234332147 |
| Sequence | CAGTCCGAACAGAGAGACGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947971947_947971951 | 11 | Left | 947971947 | 2:234332125-234332147 | CCTGCGTCTCTCTGTTCGGACTG | No data | ||
| Right | 947971951 | 2:234332159-234332181 | TGTCTCTCTGTCTGTCCCGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947971947 | Original CRISPR | CAGTCCGAACAGAGAGACGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||