ID: 947971947

View in Genome Browser
Species Human (GRCh38)
Location 2:234332125-234332147
Sequence CAGTCCGAACAGAGAGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947971947_947971951 11 Left 947971947 2:234332125-234332147 CCTGCGTCTCTCTGTTCGGACTG No data
Right 947971951 2:234332159-234332181 TGTCTCTCTGTCTGTCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947971947 Original CRISPR CAGTCCGAACAGAGAGACGC AGG (reversed) Intergenic
No off target data available for this crispr