ID: 947976011

View in Genome Browser
Species Human (GRCh38)
Location 2:234367043-234367065
Sequence CAGCTGTACTAGATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947976004_947976011 18 Left 947976004 2:234367002-234367024 CCTACATAAGCAAACAGAGCTGC No data
Right 947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG No data
947976007_947976011 -10 Left 947976007 2:234367030-234367052 CCCCTTGCAGAAGCAGCTGTACT No data
Right 947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG No data
947976003_947976011 19 Left 947976003 2:234367001-234367023 CCCTACATAAGCAAACAGAGCTG No data
Right 947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947976011 Original CRISPR CAGCTGTACTAGATGGAAGC AGG Intergenic
No off target data available for this crispr