ID: 947978550

View in Genome Browser
Species Human (GRCh38)
Location 2:234388167-234388189
Sequence CAGCTGTGCCAGAGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947978542_947978550 25 Left 947978542 2:234388119-234388141 CCTGTGCATAGGTTGTTGGGCCT No data
Right 947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG No data
947978544_947978550 5 Left 947978544 2:234388139-234388161 CCTCTTGGAATGATGACCCCAGT No data
Right 947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947978550 Original CRISPR CAGCTGTGCCAGAGGAGAAA GGG Intergenic
No off target data available for this crispr