ID: 947980110

View in Genome Browser
Species Human (GRCh38)
Location 2:234401493-234401515
Sequence CAAGTATCTGTAGCATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947980108_947980110 -9 Left 947980108 2:234401479-234401501 CCCAGTGAAAATTACAAGTATCT No data
Right 947980110 2:234401493-234401515 CAAGTATCTGTAGCATGCTCTGG No data
947980109_947980110 -10 Left 947980109 2:234401480-234401502 CCAGTGAAAATTACAAGTATCTG No data
Right 947980110 2:234401493-234401515 CAAGTATCTGTAGCATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947980110 Original CRISPR CAAGTATCTGTAGCATGCTC TGG Intergenic
No off target data available for this crispr