ID: 947980639

View in Genome Browser
Species Human (GRCh38)
Location 2:234405835-234405857
Sequence TAGGAAGGGGACTCTTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947980639_947980641 -10 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980641 2:234405848-234405870 CCCCTTCCTATGATGAGTGATGG No data
947980639_947980647 -6 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980647 2:234405852-234405874 TTCCTATGATGAGTGATGGGGGG No data
947980639_947980645 -8 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980645 2:234405850-234405872 CCTTCCTATGATGAGTGATGGGG No data
947980639_947980650 23 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980650 2:234405881-234405903 CTCCTAGAGAGGCACCTAGAAGG No data
947980639_947980643 -9 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980643 2:234405849-234405871 CCCTTCCTATGATGAGTGATGGG No data
947980639_947980646 -7 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980646 2:234405851-234405873 CTTCCTATGATGAGTGATGGGGG No data
947980639_947980649 12 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980649 2:234405870-234405892 GGGGGTGTGCACTCCTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947980639 Original CRISPR TAGGAAGGGGACTCTTGTTT TGG (reversed) Intergenic
No off target data available for this crispr