ID: 947980645

View in Genome Browser
Species Human (GRCh38)
Location 2:234405850-234405872
Sequence CCTTCCTATGATGAGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947980638_947980645 5 Left 947980638 2:234405822-234405844 CCTTACAGTCTGGCCAAAACAAG No data
Right 947980645 2:234405850-234405872 CCTTCCTATGATGAGTGATGGGG No data
947980639_947980645 -8 Left 947980639 2:234405835-234405857 CCAAAACAAGAGTCCCCTTCCTA No data
Right 947980645 2:234405850-234405872 CCTTCCTATGATGAGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947980645 Original CRISPR CCTTCCTATGATGAGTGATG GGG Intergenic
No off target data available for this crispr