ID: 947982527

View in Genome Browser
Species Human (GRCh38)
Location 2:234422577-234422599
Sequence GCCTTTGCAGGAGTGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947982527_947982531 13 Left 947982527 2:234422577-234422599 CCTGAGCTCACTCCTGCAAAGGC No data
Right 947982531 2:234422613-234422635 GAATGTTGACATTAACCAGAAGG No data
947982527_947982533 18 Left 947982527 2:234422577-234422599 CCTGAGCTCACTCCTGCAAAGGC No data
Right 947982533 2:234422618-234422640 TTGACATTAACCAGAAGGTAGGG No data
947982527_947982532 17 Left 947982527 2:234422577-234422599 CCTGAGCTCACTCCTGCAAAGGC No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947982527 Original CRISPR GCCTTTGCAGGAGTGAGCTC AGG (reversed) Intergenic
No off target data available for this crispr