ID: 947982529

View in Genome Browser
Species Human (GRCh38)
Location 2:234422599-234422621
Sequence TCAACATTCATGAATAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947982529_947982533 -4 Left 947982529 2:234422599-234422621 CCACGCCTATTCATGAATGTTGA No data
Right 947982533 2:234422618-234422640 TTGACATTAACCAGAAGGTAGGG No data
947982529_947982532 -5 Left 947982529 2:234422599-234422621 CCACGCCTATTCATGAATGTTGA No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data
947982529_947982531 -9 Left 947982529 2:234422599-234422621 CCACGCCTATTCATGAATGTTGA No data
Right 947982531 2:234422613-234422635 GAATGTTGACATTAACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947982529 Original CRISPR TCAACATTCATGAATAGGCG TGG (reversed) Intergenic