ID: 947982529 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:234422599-234422621 |
| Sequence | TCAACATTCATGAATAGGCG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947982529_947982532 | -5 | Left | 947982529 | 2:234422599-234422621 | CCACGCCTATTCATGAATGTTGA | No data | ||
| Right | 947982532 | 2:234422617-234422639 | GTTGACATTAACCAGAAGGTAGG | No data | ||||
| 947982529_947982533 | -4 | Left | 947982529 | 2:234422599-234422621 | CCACGCCTATTCATGAATGTTGA | No data | ||
| Right | 947982533 | 2:234422618-234422640 | TTGACATTAACCAGAAGGTAGGG | No data | ||||
| 947982529_947982531 | -9 | Left | 947982529 | 2:234422599-234422621 | CCACGCCTATTCATGAATGTTGA | No data | ||
| Right | 947982531 | 2:234422613-234422635 | GAATGTTGACATTAACCAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947982529 | Original CRISPR | TCAACATTCATGAATAGGCG TGG (reversed) | Intergenic | ||