ID: 947982530

View in Genome Browser
Species Human (GRCh38)
Location 2:234422604-234422626
Sequence TAATGTCAACATTCATGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947982530_947982533 -9 Left 947982530 2:234422604-234422626 CCTATTCATGAATGTTGACATTA No data
Right 947982533 2:234422618-234422640 TTGACATTAACCAGAAGGTAGGG No data
947982530_947982535 28 Left 947982530 2:234422604-234422626 CCTATTCATGAATGTTGACATTA No data
Right 947982535 2:234422655-234422677 TTGAGCTTAAATCTGAGCTGAGG No data
947982530_947982532 -10 Left 947982530 2:234422604-234422626 CCTATTCATGAATGTTGACATTA No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947982530 Original CRISPR TAATGTCAACATTCATGAAT AGG (reversed) Intergenic