ID: 947982532

View in Genome Browser
Species Human (GRCh38)
Location 2:234422617-234422639
Sequence GTTGACATTAACCAGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947982530_947982532 -10 Left 947982530 2:234422604-234422626 CCTATTCATGAATGTTGACATTA No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data
947982527_947982532 17 Left 947982527 2:234422577-234422599 CCTGAGCTCACTCCTGCAAAGGC No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data
947982528_947982532 5 Left 947982528 2:234422589-234422611 CCTGCAAAGGCCACGCCTATTCA No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data
947982529_947982532 -5 Left 947982529 2:234422599-234422621 CCACGCCTATTCATGAATGTTGA No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data
947982525_947982532 18 Left 947982525 2:234422576-234422598 CCCTGAGCTCACTCCTGCAAAGG No data
Right 947982532 2:234422617-234422639 GTTGACATTAACCAGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947982532 Original CRISPR GTTGACATTAACCAGAAGGT AGG Intergenic