ID: 947982917

View in Genome Browser
Species Human (GRCh38)
Location 2:234425576-234425598
Sequence GGTCTGAAGGGACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947982917_947982937 30 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982937 2:234425629-234425651 CCTTTGGACCTGACTCCTTGGGG No data
947982917_947982933 28 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982933 2:234425627-234425649 TCCCTTTGGACCTGACTCCTTGG No data
947982917_947982923 -1 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982923 2:234425598-234425620 CCCTGTCCCAGTTAGTCCCTGGG No data
947982917_947982928 14 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982928 2:234425613-234425635 TCCCTGGGGACCCGTCCCTTTGG No data
947982917_947982925 0 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982925 2:234425599-234425621 CCTGTCCCAGTTAGTCCCTGGGG No data
947982917_947982921 -2 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982921 2:234425597-234425619 CCCCTGTCCCAGTTAGTCCCTGG No data
947982917_947982935 29 Left 947982917 2:234425576-234425598 CCTGCTGGTGGTCCCTTCAGACC No data
Right 947982935 2:234425628-234425650 CCCTTTGGACCTGACTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947982917 Original CRISPR GGTCTGAAGGGACCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr