ID: 947984768

View in Genome Browser
Species Human (GRCh38)
Location 2:234438560-234438582
Sequence CATCCCTGGATAGCAGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947984751_947984768 28 Left 947984751 2:234438509-234438531 CCCACAGGTAAGGCTACCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG No data
947984756_947984768 12 Left 947984756 2:234438525-234438547 CCGTTGGTCTCCTGGCTCTCGGC No data
Right 947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG No data
947984753_947984768 27 Left 947984753 2:234438510-234438532 CCACAGGTAAGGCTACCGTTGGT 0: 1
1: 0
2: 0
3: 8
4: 30
Right 947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG No data
947984750_947984768 29 Left 947984750 2:234438508-234438530 CCCCACAGGTAAGGCTACCGTTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG No data
947984762_947984768 2 Left 947984762 2:234438535-234438557 CCTGGCTCTCGGCGGGCTGGGGG No data
Right 947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947984768 Original CRISPR CATCCCTGGATAGCAGCTAC GGG Intergenic
No off target data available for this crispr