ID: 947987268

View in Genome Browser
Species Human (GRCh38)
Location 2:234459693-234459715
Sequence ATGGCTTGGTGCCCTCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947987260_947987268 18 Left 947987260 2:234459652-234459674 CCTAACGGGTGGTGCTCGGGTCT No data
Right 947987268 2:234459693-234459715 ATGGCTTGGTGCCCTCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947987268 Original CRISPR ATGGCTTGGTGCCCTCTTGT AGG Intergenic
No off target data available for this crispr