ID: 947992248

View in Genome Browser
Species Human (GRCh38)
Location 2:234497001-234497023
Sequence CCCGGAGCGCGGGCTTCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947992237_947992248 1 Left 947992237 2:234496977-234496999 CCTGCTCCTGCTCCCGCTCCCGC 0: 1
1: 14
2: 70
3: 371
4: 1810
Right 947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 151
947992235_947992248 25 Left 947992235 2:234496953-234496975 CCTCTGGCCTGGGACGGCGCTGC 0: 1
1: 0
2: 0
3: 11
4: 218
Right 947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 151
947992236_947992248 18 Left 947992236 2:234496960-234496982 CCTGGGACGGCGCTGCTCCTGCT 0: 1
1: 0
2: 1
3: 20
4: 257
Right 947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 151
947992238_947992248 -5 Left 947992238 2:234496983-234497005 CCTGCTCCCGCTCCCGCTCCCGG 0: 2
1: 18
2: 44
3: 220
4: 1438
Right 947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947992248 Original CRISPR CCCGGAGCGCGGGCTTCCCC GGG Exonic
900368586 1:2321514-2321536 CCTGGGGCGCAGGCTGCCCCCGG - Exonic
901875694 1:12165924-12165946 CCAGGAGAGCTGGCTTCCCCAGG - Intergenic
903280130 1:22245581-22245603 CCAGGAGAGAGGGCTCCCCCTGG + Intergenic
905012982 1:34759621-34759643 GCAGGAGGGCGGACTTCCCCGGG - Intronic
905169200 1:36099416-36099438 CCCGAGGCCCGGGCTTCCCAGGG + Exonic
910251196 1:85200908-85200930 CCCGGAGCCCGGGCTCCCGCGGG + Exonic
913267511 1:117059806-117059828 CCTGCAGCGGCGGCTTCCCCTGG + Intergenic
914373386 1:147050783-147050805 CCGGGAGCCCGCGCCTCCCCCGG - Intergenic
914490246 1:148146982-148147004 GCCGGGGGGCGGGCTTCCCTGGG + Intronic
914492290 1:148160104-148160126 CCCAGATCCCCGGCTTCCCCGGG + Intergenic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
921390290 1:214608231-214608253 GCCGGGGGGCGGGCTTCCCTGGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1062843668 10:689347-689369 CCCGGAGCGTGCGCGTCCCCCGG - Intronic
1062888116 10:1034973-1034995 CCAGGAACGCAGGCCTCCCCAGG + Intergenic
1062890467 10:1056450-1056472 CCCTGAGCGCAGGCGGCCCCGGG + Intronic
1065883718 10:30059189-30059211 CTCGGAGCGCGGGGGTCCCGGGG - Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1071532405 10:86400398-86400420 ACCGGCGGGCGGTCTTCCCCGGG - Intergenic
1071602777 10:86966986-86967008 CCCAGAGCGAGGCCTTGCCCTGG - Intronic
1072749027 10:97963294-97963316 CCAGGAGCACTGGCATCCCCTGG + Intronic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1073207283 10:101775880-101775902 CGCGGAGCGGGGGCTGCCCATGG + Exonic
1074815205 10:117137434-117137456 TCCAGAGCGCGGGAGTCCCCTGG + Intronic
1075040581 10:119104260-119104282 GCGGGAGCCCGGGCTGCCCCGGG - Intronic
1075646903 10:124102688-124102710 CCAGGAGGGCTGGCTTCACCAGG - Intergenic
1076452818 10:130568465-130568487 CCAGGAGCACGGTCTGCCCCGGG + Intergenic
1076858786 10:133129918-133129940 CACGGAGTCCTGGCTTCCCCTGG + Exonic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077475737 11:2789623-2789645 CCCGGAGCGCAGCTGTCCCCTGG - Intronic
1079451196 11:20601230-20601252 CCCGGAGCAGGAGCTTCCCGCGG + Exonic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1081662597 11:44897062-44897084 CCCACAGCCCAGGCTTCCCCAGG + Intronic
1083869337 11:65477410-65477432 CCAGGAGCGCGGCCTCCTCCCGG + Intergenic
1083970151 11:66069899-66069921 GGCGGAGAGCCGGCTTCCCCGGG + Intergenic
1085502563 11:77037396-77037418 CCCGGAGTGCTGCCATCCCCTGG - Intronic
1089590011 11:119534000-119534022 CCCGGCTCTCGGGCTCCCCCTGG + Intergenic
1091259808 11:134225055-134225077 ACCGGGGCGCGGGCTGCCCTAGG - Exonic
1092053376 12:5489327-5489349 CTTGGAGCTTGGGCTTCCCCTGG + Intronic
1097106514 12:56629511-56629533 CCCGGAGTGCGCGATTCTCCCGG + Intronic
1099890117 12:88580184-88580206 CAGGGAGCGCCGGCTTCCCCGGG + Intronic
1101836395 12:108298748-108298770 CCTGGAGAATGGGCTTCCCCTGG - Intronic
1103138303 12:118526941-118526963 CCCGGAAGGAGGACTTCCCCTGG + Intergenic
1103883213 12:124182495-124182517 CCCAGGGCGAGGGCTTCCCGAGG - Intronic
1103947608 12:124535258-124535280 TCAGGAGGGTGGGCTTCCCCGGG - Intronic
1114633075 14:24172051-24172073 CCCGAAGCGCTCGCTTCCCGCGG + Exonic
1116849366 14:49893123-49893145 CCCCGAGCGCGGGCTCCCTCCGG - Exonic
1118796707 14:69151766-69151788 CGCGGGGCCCGGGCCTCCCCGGG + Intronic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1119622104 14:76138917-76138939 CGGGGAGCGCAGGCTCCCCCAGG + Intergenic
1121105702 14:91278109-91278131 CCCGGTGTGCTGGCTTCCCGGGG + Exonic
1122974853 14:105166910-105166932 CCTGGAGCACGGCCTTGCCCTGG - Intronic
1128149636 15:65355163-65355185 CGCGGGGGCCGGGCTTCCCCAGG - Intronic
1128454876 15:67826857-67826879 CCCGCAGCGCGGACTTGGCCTGG + Exonic
1129261834 15:74373075-74373097 CCCGCAGCGGGGGCCTCCCAAGG - Intergenic
1129685882 15:77685961-77685983 CCTGGGGCCTGGGCTTCCCCAGG + Intronic
1129917026 15:79283057-79283079 CCGGGAGCTGGGGCTACCCCGGG - Intergenic
1130013458 15:80170119-80170141 CCCGGAGCGCTGCCTCCCCCAGG - Intronic
1132331526 15:101015370-101015392 CCCGGAGCGCTGGCGACCTCTGG - Exonic
1132559934 16:589046-589068 CCCGGACCGCGCTCTTCCCGGGG - Intergenic
1132683830 16:1154092-1154114 CCCGGGGCGCGGGACTCCCTCGG + Intronic
1133040647 16:3058467-3058489 CACGGAGCTGGGGCTGCCCCCGG + Exonic
1133128724 16:3663340-3663362 CCCGCAGCGAGGGCTTCCTTTGG - Exonic
1135532688 16:23268008-23268030 GCAGGAGCGAGGGTTTCCCCAGG + Intergenic
1136396656 16:29996169-29996191 CCCTGAGCGCGGGGTACGCCGGG + Exonic
1137555046 16:49465130-49465152 GCCTGAGCGCGGGGTTCCCTCGG + Intergenic
1137617020 16:49854727-49854749 GCCGGCGCGCGGCCTTTCCCCGG + Intronic
1140753391 16:78046184-78046206 GCTGCAGCGCTGGCTTCCCCGGG + Intronic
1141694730 16:85614006-85614028 CCCGGGGCGCGCCCTTCCTCGGG - Intronic
1142129769 16:88427358-88427380 CCATGAGCGCAGGCTTCCCTGGG + Intergenic
1143150761 17:4806841-4806863 CGCGCAGCGCGGGGTGCCCCGGG + Intergenic
1144685124 17:17221104-17221126 CCAGGTGCCTGGGCTTCCCCAGG - Intronic
1145190838 17:20841585-20841607 GCCGGGGGGCGGGCTTCCCTGGG + Intronic
1145244677 17:21260729-21260751 CCGGGACAGCTGGCTTCCCCAGG + Intergenic
1146002999 17:29142518-29142540 CCAGCAGCGTGGGCATCCCCTGG + Intronic
1146631021 17:34469348-34469370 CCAGGAGTGCTGGCTTCCACTGG + Intergenic
1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG + Intronic
1147617182 17:41836336-41836358 CCCGGATCGCGGCCATCTCCGGG - Intronic
1147741283 17:42672258-42672280 CCCGGAGCGCGGGCAAGTCCCGG + Exonic
1154302680 18:13208043-13208065 CCCGGAGCTCATGCTTGCCCAGG - Intergenic
1155060361 18:22223062-22223084 CCTGCAGCGTGGGCATCCCCTGG + Intergenic
1155501528 18:26491681-26491703 CCTGGAGCTCTGGCTTCCTCGGG + Intronic
1157121839 18:44918344-44918366 CCTGGAGCGTAGGTTTCCCCAGG + Intronic
1159040325 18:63318527-63318549 CCCGGTGCGGGGGCGGCCCCCGG + Exonic
1160995366 19:1879838-1879860 GCCGGGGGGCGGGCTTCCCTGGG - Intronic
1161309287 19:3585358-3585380 CCCGGACTGCGGGTATCCCCGGG + Intergenic
1161797008 19:6393070-6393092 CACCGAGCGGCGGCTTCCCCGGG - Exonic
1167112574 19:47470941-47470963 CCCGCAGAGTGGGCTCCCCCAGG - Intronic
1167517391 19:49930988-49931010 CCTGGAGGGCGGGCTTCCAGTGG + Exonic
1168148049 19:54430471-54430493 CCCAGTGCCCGGCCTTCCCCCGG + Intronic
1168459173 19:56539146-56539168 CCTTGAGCGCGGCCTTCCCCGGG - Exonic
925030702 2:648273-648295 CCTGGAGCGAGGGCTGTCCCTGG - Intergenic
925817461 2:7767511-7767533 CCCGGGGCCCTGGCTTTCCCTGG + Intergenic
930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG + Intronic
932407815 2:71525510-71525532 CACGGCGCCCAGGCTTCCCCAGG + Intronic
932489929 2:72114134-72114156 CCAGGAGCCGGGGCTTCCTCAGG + Intergenic
936301773 2:111309874-111309896 CCTGCAGTGCGGGCCTCCCCAGG + Intergenic
937853442 2:126656183-126656205 CCGGGAGCGCGACCCTCCCCCGG + Exonic
942452155 2:176115036-176115058 CCCGAGGCCCGGGCTTCCGCAGG + Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948402003 2:237691744-237691766 CCCGGAGCGCCCGCTTCCCACGG + Intronic
948926524 2:241102219-241102241 CTGGGCGCGCGGGCTTCTCCGGG - Intronic
1172884056 20:38219665-38219687 CACGGAGCTCCAGCTTCCCCAGG + Exonic
1174658531 20:52191556-52191578 CCCGGAGCGCGCACTGCTCCCGG + Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1178689912 21:34742334-34742356 CCAGGAGCACCGGCTACCCCAGG + Intergenic
1178914620 21:36699505-36699527 CCCGGAGCGCAGCCTCCTCCGGG - Exonic
1179833294 21:44012001-44012023 CCCGCAGCTCGGGCGTCCCGCGG - Intergenic
1181121440 22:20670378-20670400 GCCGGGGGGCGGGCTTCCCTGGG - Intergenic
1181334399 22:22117402-22117424 GCCGGGGGGCGGGCTTCCCTGGG - Intergenic
1183427387 22:37746870-37746892 CACGGAGGGCTGGCTTGCCCAGG - Intronic
1183586514 22:38755952-38755974 CGCGCAGCGCGGGCCTCCGCCGG - Exonic
1184046794 22:41976982-41977004 AGCGGGGCGCGGGCTTCCCCGGG - Exonic
1184141830 22:42582010-42582032 CCGGGAGCGCGGGGGTCGCCGGG + Intergenic
1184164641 22:42720379-42720401 CCCGACGCCCAGGCTTCCCCCGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
950469033 3:13173385-13173407 CCTGCAGCCCGGGCTCCCCCGGG + Intergenic
953705440 3:45226516-45226538 CCCGGAGCGCGGGGGCGCCCGGG - Intergenic
956414597 3:69013321-69013343 CCCGGAGCGCAGGCGGGCCCCGG - Intronic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968042178 3:195597869-195597891 CCAGGAGTGTGGTCTTCCCCTGG - Intergenic
968606021 4:1536152-1536174 CCCAGAGCGGGGGCTCCCCAGGG + Intergenic
969714408 4:8861345-8861367 CCCGGAGGCCGCGCTTCCCGCGG + Intronic
970609122 4:17709251-17709273 CCCGCAGGGCCGGCTGCCCCAGG - Exonic
975448177 4:74492614-74492636 CCCAGATCGTGTGCTTCCCCAGG - Intergenic
980158471 4:129133548-129133570 CCCTGAGGGCGCTCTTCCCCTGG - Intergenic
981475295 4:145180842-145180864 CCCGGCGCGCGCGATTCCCGCGG - Intergenic
983990287 4:174110312-174110334 CTAGGAGCACGTGCTTCCCCTGG + Intergenic
985446331 4:190022837-190022859 TTCGGAGGGCGGGCTACCCCGGG - Intergenic
986560075 5:9051922-9051944 CCCGGAGCACTGGCTGCCCATGG + Exonic
992530224 5:77645681-77645703 CCCGCAGCGCGGCCTCCTCCCGG + Intergenic
993901237 5:93585195-93585217 CCCGGAGCGCCCGCCACCCCCGG + Exonic
1001939420 5:175729949-175729971 CCCCGTGCCTGGGCTTCCCCTGG - Intergenic
1006012442 6:31054178-31054200 CCCGGAGCTCTGGCTTCCCTCGG + Intergenic
1011195126 6:84773379-84773401 TCCGGAGCGGGGGCTTACACTGG - Intergenic
1016461852 6:144286267-144286289 GCCGGAGCCCCGCCTTCCCCGGG - Intronic
1018869416 6:167769929-167769951 CCCAGAGCTCGGTCTTCCCATGG + Intergenic
1019186366 6:170222984-170223006 CGCGGAGGGCGGGCTTCTCAGGG - Intergenic
1019395742 7:816783-816805 CCCTCAGCGCGGGCTGCGCCAGG + Intronic
1019528606 7:1492856-1492878 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019528633 7:1492924-1492946 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019528647 7:1492958-1492980 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1026360677 7:69599002-69599024 TCCGGAGCCCCGGCCTCCCCTGG + Intronic
1027224464 7:76235201-76235223 CGCGGTGCGCGCGCTTCACCAGG - Exonic
1027278743 7:76590434-76590456 CCCGAAGTGGGGGCCTCCCCTGG - Intergenic
1034339184 7:150341196-150341218 CCCGGCGCGGGGGCTGCCGCGGG + Exonic
1034837526 7:154366015-154366037 CCAGCAGCGCAGGCTTACCCCGG - Intronic
1037359087 8:18054211-18054233 CCCACAGCCCGGGCTTCCTCTGG - Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1039617721 8:38969652-38969674 CCAGGAGCGCTGCCCTCCCCAGG - Exonic
1043969610 8:86514784-86514806 CCCCGAGCCCGGGCTCCTCCAGG - Intronic
1044692871 8:94896180-94896202 CCCTGAGCGCGGTGGTCCCCGGG + Intronic
1049532195 8:143160200-143160222 CCCGGAGTGCGGACACCCCCGGG - Exonic
1049785303 8:144448003-144448025 ACTGGAGCACGGGCTTCCCGTGG - Intergenic
1051855324 9:21559282-21559304 CCCGGAGCGCCGGCCGCCCTTGG - Intergenic
1052971523 9:34379967-34379989 CCCGGAGCCCGACCTTCCCCAGG - Intronic
1057950578 9:99366296-99366318 CCAGGTGCCCGGGCATCCCCAGG - Intergenic
1058663051 9:107283531-107283553 CGAGGAGCGCGGGCGACCCCGGG + Exonic
1059529942 9:115026645-115026667 CCCGGAGCTCGTACTGCCCCTGG + Exonic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061860343 9:133464750-133464772 TCCCCAGCGTGGGCTTCCCCTGG + Intronic
1062357096 9:136170166-136170188 CCGGGGGCCCGGGCTTGCCCAGG - Intergenic
1189308602 X:40005395-40005417 CCCGGGGCGCGGGCGAGCCCTGG + Intergenic
1192533662 X:71910877-71910899 CCTAGAGCGCCGGCTCCCCCGGG - Intergenic
1195668493 X:107450400-107450422 CCCTGGGCTCGGGCTTCGCCGGG - Intergenic
1200208206 X:154332834-154332856 CTTGGAGCCCGGCCTTCCCCGGG + Intergenic