ID: 947993106

View in Genome Browser
Species Human (GRCh38)
Location 2:234502583-234502605
Sequence TGACCACACATTAGAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947993106_947993110 12 Left 947993106 2:234502583-234502605 CCACCCTCTCTAATGTGTGGTCA No data
Right 947993110 2:234502618-234502640 CTTCCCTTTAATACAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947993106 Original CRISPR TGACCACACATTAGAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr