ID: 947995396

View in Genome Browser
Species Human (GRCh38)
Location 2:234523116-234523138
Sequence CTCAGGAAACACAATAATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947995396_947995405 11 Left 947995396 2:234523116-234523138 CCGCCATTATTGTGTTTCCTGAG No data
Right 947995405 2:234523150-234523172 CATGCTTCCTGTACAGCCTATGG 0: 60
1: 697
2: 1057
3: 1114
4: 805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947995396 Original CRISPR CTCAGGAAACACAATAATGG CGG (reversed) Intergenic
No off target data available for this crispr