ID: 947995610

View in Genome Browser
Species Human (GRCh38)
Location 2:234524709-234524731
Sequence CACCTTGCTGCTGCATCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947995610_947995613 11 Left 947995610 2:234524709-234524731 CCAGAGGATGCAGCAGCAAGGTG No data
Right 947995613 2:234524743-234524765 GCAGAGACTAAGCCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947995610 Original CRISPR CACCTTGCTGCTGCATCCTC TGG (reversed) Intergenic
No off target data available for this crispr