ID: 947998056

View in Genome Browser
Species Human (GRCh38)
Location 2:234545008-234545030
Sequence GGGGATCCTTGAGAAAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947998056_947998059 -9 Left 947998056 2:234545008-234545030 CCGTCTCTTTCTCAAGGATCCCC No data
Right 947998059 2:234545022-234545044 AGGATCCCCAGTGTGGAAGCGGG No data
947998056_947998067 21 Left 947998056 2:234545008-234545030 CCGTCTCTTTCTCAAGGATCCCC No data
Right 947998067 2:234545052-234545074 CAGCAAACCCATGCAGCATCAGG No data
947998056_947998070 30 Left 947998056 2:234545008-234545030 CCGTCTCTTTCTCAAGGATCCCC No data
Right 947998070 2:234545061-234545083 CATGCAGCATCAGGCAGCGCAGG No data
947998056_947998058 -10 Left 947998056 2:234545008-234545030 CCGTCTCTTTCTCAAGGATCCCC No data
Right 947998058 2:234545021-234545043 AAGGATCCCCAGTGTGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947998056 Original CRISPR GGGGATCCTTGAGAAAGAGA CGG (reversed) Intergenic
No off target data available for this crispr