ID: 947998057

View in Genome Browser
Species Human (GRCh38)
Location 2:234545015-234545037
Sequence TTTCTCAAGGATCCCCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947998054_947998057 0 Left 947998054 2:234544992-234545014 CCAAAGTCATCAAAGACCGTCTC No data
Right 947998057 2:234545015-234545037 TTTCTCAAGGATCCCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947998057 Original CRISPR TTTCTCAAGGATCCCCAGTG TGG Intergenic