ID: 947998058

View in Genome Browser
Species Human (GRCh38)
Location 2:234545021-234545043
Sequence AAGGATCCCCAGTGTGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947998056_947998058 -10 Left 947998056 2:234545008-234545030 CCGTCTCTTTCTCAAGGATCCCC No data
Right 947998058 2:234545021-234545043 AAGGATCCCCAGTGTGGAAGCGG No data
947998054_947998058 6 Left 947998054 2:234544992-234545014 CCAAAGTCATCAAAGACCGTCTC No data
Right 947998058 2:234545021-234545043 AAGGATCCCCAGTGTGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947998058 Original CRISPR AAGGATCCCCAGTGTGGAAG CGG Intergenic
No off target data available for this crispr