ID: 948000288

View in Genome Browser
Species Human (GRCh38)
Location 2:234562189-234562211
Sequence CATCAGGGGGAGACCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948000288_948000297 13 Left 948000288 2:234562189-234562211 CCTTCCATGGTCTCCCCCTGATG No data
Right 948000297 2:234562225-234562247 GGACTGTACTGCTGCGATCTCGG 0: 17
1: 810
2: 531
3: 1422
4: 25844
948000288_948000293 -8 Left 948000288 2:234562189-234562211 CCTTCCATGGTCTCCCCCTGATG No data
Right 948000293 2:234562204-234562226 CCCTGATGCCGAGCCGAAGCTGG 0: 4
1: 455
2: 574
3: 447
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948000288 Original CRISPR CATCAGGGGGAGACCATGGA AGG (reversed) Intergenic
No off target data available for this crispr