ID: 948002256

View in Genome Browser
Species Human (GRCh38)
Location 2:234577831-234577853
Sequence GGCCCACGGCAGCACTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948002256_948002266 24 Left 948002256 2:234577831-234577853 CCCTACCAGTGCTGCCGTGGGCC No data
Right 948002266 2:234577878-234577900 CAGTTCATCTTCATGATCTTTGG No data
948002256_948002262 -3 Left 948002256 2:234577831-234577853 CCCTACCAGTGCTGCCGTGGGCC No data
Right 948002262 2:234577851-234577873 GCCAGGGCTTGAGCCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948002256 Original CRISPR GGCCCACGGCAGCACTGGTA GGG (reversed) Intergenic
No off target data available for this crispr