ID: 948003794

View in Genome Browser
Species Human (GRCh38)
Location 2:234590827-234590849
Sequence GGGCGGGGCTCTCTAGATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948003794_948003801 0 Left 948003794 2:234590827-234590849 CCCGAATCTAGAGAGCCCCGCCC No data
Right 948003801 2:234590850-234590872 TGCAGTCCCACCAGAATGCTTGG No data
948003794_948003805 19 Left 948003794 2:234590827-234590849 CCCGAATCTAGAGAGCCCCGCCC No data
Right 948003805 2:234590869-234590891 TTGGTGATACGCAATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948003794 Original CRISPR GGGCGGGGCTCTCTAGATTC GGG (reversed) Intergenic
No off target data available for this crispr