ID: 948006265

View in Genome Browser
Species Human (GRCh38)
Location 2:234610333-234610355
Sequence TTCTGGGCTCCTCTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948006265_948006274 21 Left 948006265 2:234610333-234610355 CCTTCCTCTAGAGGAGCCCAGAA No data
Right 948006274 2:234610377-234610399 CAAATGTCTGATGCTCCAGGAGG No data
948006265_948006272 18 Left 948006265 2:234610333-234610355 CCTTCCTCTAGAGGAGCCCAGAA No data
Right 948006272 2:234610374-234610396 TGCCAAATGTCTGATGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948006265 Original CRISPR TTCTGGGCTCCTCTAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr