ID: 948007376

View in Genome Browser
Species Human (GRCh38)
Location 2:234621509-234621531
Sequence TTATTAGAAGGCACCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948007376_948007379 13 Left 948007376 2:234621509-234621531 CCTTGCTGGGTGCCTTCTAATAA No data
Right 948007379 2:234621545-234621567 CACAGAGCACTTAGCCTGTCTGG No data
948007376_948007380 21 Left 948007376 2:234621509-234621531 CCTTGCTGGGTGCCTTCTAATAA No data
Right 948007380 2:234621553-234621575 ACTTAGCCTGTCTGGCCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948007376 Original CRISPR TTATTAGAAGGCACCCAGCA AGG (reversed) Intergenic
No off target data available for this crispr