ID: 948007767

View in Genome Browser
Species Human (GRCh38)
Location 2:234624420-234624442
Sequence CCTGGGGCCCCCGTATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948007759_948007767 5 Left 948007759 2:234624392-234624414 CCTCCAGGGTGTGAGCACTCACT No data
Right 948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG No data
948007760_948007767 2 Left 948007760 2:234624395-234624417 CCAGGGTGTGAGCACTCACTTCC No data
Right 948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG No data
948007758_948007767 14 Left 948007758 2:234624383-234624405 CCTGAGTCTCCTCCAGGGTGTGA No data
Right 948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948007767 Original CRISPR CCTGGGGCCCCCGTATCCTT GGG Intergenic
No off target data available for this crispr