ID: 948014450

View in Genome Browser
Species Human (GRCh38)
Location 2:234676646-234676668
Sequence CTGCTCCTCCCTGGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948014446_948014450 7 Left 948014446 2:234676616-234676638 CCTAGGAATCTGAATGTTGAGTA No data
Right 948014450 2:234676646-234676668 CTGCTCCTCCCTGGGAATGCTGG No data
948014444_948014450 27 Left 948014444 2:234676596-234676618 CCAGTTGGTCTGGGCAGGGGCCT No data
Right 948014450 2:234676646-234676668 CTGCTCCTCCCTGGGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948014450 Original CRISPR CTGCTCCTCCCTGGGAATGC TGG Intergenic
No off target data available for this crispr