ID: 948014509

View in Genome Browser
Species Human (GRCh38)
Location 2:234677084-234677106
Sequence ACTCAGATGCAGACTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948014509_948014516 6 Left 948014509 2:234677084-234677106 CCATCTGCAGTCTGCATCTGAGT No data
Right 948014516 2:234677113-234677135 GGAAGAGGCAGGAACTCAAATGG No data
948014509_948014513 -5 Left 948014509 2:234677084-234677106 CCATCTGCAGTCTGCATCTGAGT No data
Right 948014513 2:234677102-234677124 TGAGTGCCCAGGGAAGAGGCAGG No data
948014509_948014512 -9 Left 948014509 2:234677084-234677106 CCATCTGCAGTCTGCATCTGAGT No data
Right 948014512 2:234677098-234677120 CATCTGAGTGCCCAGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948014509 Original CRISPR ACTCAGATGCAGACTGCAGA TGG (reversed) Intergenic
No off target data available for this crispr