ID: 948014512

View in Genome Browser
Species Human (GRCh38)
Location 2:234677098-234677120
Sequence CATCTGAGTGCCCAGGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948014508_948014512 6 Left 948014508 2:234677069-234677091 CCGGTCTTTGTTTGGCCATCTGC No data
Right 948014512 2:234677098-234677120 CATCTGAGTGCCCAGGGAAGAGG No data
948014505_948014512 29 Left 948014505 2:234677046-234677068 CCTGGGGCACAGGGGCACAAGAA No data
Right 948014512 2:234677098-234677120 CATCTGAGTGCCCAGGGAAGAGG No data
948014509_948014512 -9 Left 948014509 2:234677084-234677106 CCATCTGCAGTCTGCATCTGAGT No data
Right 948014512 2:234677098-234677120 CATCTGAGTGCCCAGGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948014512 Original CRISPR CATCTGAGTGCCCAGGGAAG AGG Intergenic
No off target data available for this crispr