ID: 948014513

View in Genome Browser
Species Human (GRCh38)
Location 2:234677102-234677124
Sequence TGAGTGCCCAGGGAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948014509_948014513 -5 Left 948014509 2:234677084-234677106 CCATCTGCAGTCTGCATCTGAGT No data
Right 948014513 2:234677102-234677124 TGAGTGCCCAGGGAAGAGGCAGG No data
948014508_948014513 10 Left 948014508 2:234677069-234677091 CCGGTCTTTGTTTGGCCATCTGC No data
Right 948014513 2:234677102-234677124 TGAGTGCCCAGGGAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948014513 Original CRISPR TGAGTGCCCAGGGAAGAGGC AGG Intergenic
No off target data available for this crispr