ID: 948014516

View in Genome Browser
Species Human (GRCh38)
Location 2:234677113-234677135
Sequence GGAAGAGGCAGGAACTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948014509_948014516 6 Left 948014509 2:234677084-234677106 CCATCTGCAGTCTGCATCTGAGT No data
Right 948014516 2:234677113-234677135 GGAAGAGGCAGGAACTCAAATGG No data
948014508_948014516 21 Left 948014508 2:234677069-234677091 CCGGTCTTTGTTTGGCCATCTGC No data
Right 948014516 2:234677113-234677135 GGAAGAGGCAGGAACTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948014516 Original CRISPR GGAAGAGGCAGGAACTCAAA TGG Intergenic
No off target data available for this crispr