ID: 948014516 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:234677113-234677135 |
Sequence | GGAAGAGGCAGGAACTCAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
948014509_948014516 | 6 | Left | 948014509 | 2:234677084-234677106 | CCATCTGCAGTCTGCATCTGAGT | No data | ||
Right | 948014516 | 2:234677113-234677135 | GGAAGAGGCAGGAACTCAAATGG | No data | ||||
948014508_948014516 | 21 | Left | 948014508 | 2:234677069-234677091 | CCGGTCTTTGTTTGGCCATCTGC | No data | ||
Right | 948014516 | 2:234677113-234677135 | GGAAGAGGCAGGAACTCAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
948014516 | Original CRISPR | GGAAGAGGCAGGAACTCAAA TGG | Intergenic | ||
No off target data available for this crispr |