ID: 948015093

View in Genome Browser
Species Human (GRCh38)
Location 2:234682626-234682648
Sequence TGGCCTCTCTGGTCCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015093_948015102 17 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015093_948015103 21 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015093_948015101 6 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300
948015093_948015104 28 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015093 Original CRISPR TGGCCTCTCTGGTCCCAGGA GGG (reversed) Intergenic
No off target data available for this crispr