ID: 948015094

View in Genome Browser
Species Human (GRCh38)
Location 2:234682627-234682649
Sequence CTGGCCTCTCTGGTCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015094_948015102 16 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015094_948015103 20 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015094_948015104 27 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225
948015094_948015101 5 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015094 Original CRISPR CTGGCCTCTCTGGTCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr