ID: 948015100

View in Genome Browser
Species Human (GRCh38)
Location 2:234682646-234682668
Sequence TGAAAAGAACATGCCCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015100_948015102 -3 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015100_948015103 1 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015103 2:234682670-234682692 AGTGAAGGCAGACCACAGGCTGG 0: 1
1: 0
2: 2
3: 23
4: 286
948015100_948015106 30 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015106 2:234682699-234682721 GAAATGCATGATGCTTCCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 167
948015100_948015104 8 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015104 2:234682677-234682699 GCAGACCACAGGCTGGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015100 Original CRISPR TGAAAAGAACATGCCCCAAC TGG (reversed) Intergenic