ID: 948015101

View in Genome Browser
Species Human (GRCh38)
Location 2:234682655-234682677
Sequence GCATGTTCTTTTCATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 2, 2: 6, 3: 37, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015099_948015101 -5 Left 948015099 2:234682637-234682659 CCAGAGAGGCCAGTTGGGGCATG No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300
948015094_948015101 5 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300
948015089_948015101 20 Left 948015089 2:234682612-234682634 CCACGAGTCTCTTGCCCTCCTGG No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300
948015093_948015101 6 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300
948015095_948015101 2 Left 948015095 2:234682630-234682652 CCTGGGACCAGAGAGGCCAGTTG No data
Right 948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG 0: 1
1: 2
2: 6
3: 37
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015101 Original CRISPR GCATGTTCTTTTCATAGTGA AGG Intergenic
903505370 1:23830974-23830996 GCATTTTTTTTTAATAGAGACGG + Intronic
906803179 1:48755237-48755259 GCCTGGTCTTTTCAGACTGATGG - Intronic
908035798 1:60051448-60051470 GCATGTCCTTCTCATACTGATGG - Intronic
910138196 1:83997961-83997983 GCATCTTTCTTTCATATTGAAGG + Intronic
911519054 1:98907145-98907167 GCATCTTCTTTCCACAGTCAAGG - Intronic
912656539 1:111490987-111491009 GCATGTGCTTTTCTGAGTGTGGG - Intronic
914990654 1:152496969-152496991 TCATGTATTTTTCATAGAGACGG - Intergenic
916276904 1:163004088-163004110 GCATCTTCTTCTCATAGAGTTGG + Intergenic
919047253 1:192469025-192469047 GCATGATATATTCAAAGTGAAGG - Intergenic
919895347 1:202006416-202006438 CCATTTTTTTTTCTTAGTGATGG - Intergenic
923125651 1:231032436-231032458 GCATGATCCTGTCACAGTGAGGG - Intronic
1063020017 10:2117869-2117891 GCATGTTCTTCTCATGGTTATGG - Intergenic
1063027308 10:2193141-2193163 CCATGTTCTTGTCCTAGTCAGGG + Intergenic
1064326533 10:14356470-14356492 TCATGCTCTTTTCTTTGTGAAGG - Intronic
1065446565 10:25808339-25808361 GCTTGTCCTTTTCTTATTGATGG - Intergenic
1065630353 10:27674706-27674728 CAATGTGCTTTTCAGAGTGACGG - Exonic
1066601199 10:37108921-37108943 GCATATTCTTTTCATGGTTGAGG - Intergenic
1067025565 10:42840834-42840856 CCATGTTCATTTCAGAGTGGAGG - Intergenic
1067094897 10:43293961-43293983 GCATGATCTTTTCATAGATGGGG - Intergenic
1067480740 10:46595840-46595862 GAAAGCTCTTTTCATGGTGAAGG + Intergenic
1067613999 10:47745961-47745983 GAAAGCTCTTTTCATGGTGAAGG - Intergenic
1070335144 10:75448565-75448587 GCATTTTATTGTCACAGTGATGG + Intronic
1071286951 10:84157829-84157851 GCATGTTCTGTTTTTGGTGAAGG + Intergenic
1072301850 10:94069427-94069449 GCATGTATTTTTAATAGAGATGG - Intronic
1073792421 10:106954148-106954170 GCATGTTCTTTCCACTGTGCAGG + Intronic
1074181645 10:111070126-111070148 GCTTCTTCTTTTCTTAGAGATGG - Intergenic
1074800778 10:116998997-116999019 GCATTTTCTTTTTAGAGAGATGG + Intronic
1076532606 10:131154776-131154798 GCACCTTCTTCTCAAAGTGAGGG - Intronic
1077707583 11:4503004-4503026 TCATGTTCTTTTTATGGTGATGG + Intergenic
1077944737 11:6883836-6883858 GCATTTTACTTTAATAGTGATGG - Intergenic
1078259701 11:9694071-9694093 GCATGTTGTACTCATGGTGAAGG + Intronic
1078710895 11:13789980-13790002 GCATGTTCTTTTCATGGGGATGG - Intergenic
1078829000 11:14960960-14960982 GTATGTTCTTTTCATGGTGATGG + Intronic
1079342275 11:19621824-19621846 TCTAGTTCTTTTCATTGTGATGG + Intronic
1080406280 11:31982344-31982366 CCATGTTCTTTTTGTGGTGATGG + Intronic
1086782709 11:90928330-90928352 GATTGTTCTTGTGATAGTGAGGG - Intergenic
1088389857 11:109302047-109302069 GCTTTTTCTTTTCATTGTGGTGG + Intergenic
1092139493 12:6173028-6173050 ACATGTTCTTGTGACAGTGAAGG + Intergenic
1092264112 12:6968102-6968124 GCATGTTGTATTGAGAGTGAAGG - Intronic
1092749511 12:11705723-11705745 GAATATTCTTTTCATTATGAGGG - Intronic
1093090715 12:14917216-14917238 GCATGTTCTCTTCATACTCTGGG + Exonic
1093382081 12:18505360-18505382 GCATGATATTATCATTGTGACGG - Exonic
1094036835 12:26081185-26081207 TGATGTTCTTGTGATAGTGAAGG - Intergenic
1095864550 12:46957214-46957236 GCATATTCTTATTATAGTGATGG + Intergenic
1096757140 12:53809057-53809079 TCTTGTTCTTCTCATAGTGTTGG + Intergenic
1096779796 12:53985246-53985268 GCATGTCATTTTCAGAGAGAGGG - Exonic
1097311125 12:58120532-58120554 ACATGTTCTTTACATAGATAAGG - Intergenic
1097985136 12:65775153-65775175 GAATGTTTTTTCCATAGTGCTGG + Intergenic
1098598025 12:72295390-72295412 CCATGTTCCTATCATAGTGACGG - Intronic
1098624651 12:72648774-72648796 GTATTTTTTTTTCATAGAGATGG - Intronic
1099321821 12:81160707-81160729 CCAATTTCTTTTCATAGTTAGGG + Intronic
1099937479 12:89144636-89144658 TTGTGTTCTTTTCAGAGTGAAGG + Intergenic
1100082047 12:90864394-90864416 GCATGTTATTTCCGTGGTGATGG - Intergenic
1100514360 12:95312754-95312776 GCATAATCTTTTCATTATGAAGG + Intergenic
1101845645 12:108361112-108361134 GCATGTGCTTTTCAAGGTGATGG + Intergenic
1102411202 12:112720679-112720701 GCATGTTCTTTTCTTGGTACTGG + Intronic
1102503396 12:113368448-113368470 GCTTGTTCTTCCCATGGTGATGG + Intronic
1102617155 12:114164671-114164693 TCATGTTCTTCCCATTGTGATGG + Intergenic
1104191230 12:126483477-126483499 CCTTGTTCTTTCCCTAGTGATGG + Intergenic
1104860919 12:131923031-131923053 GAATGTTCTCTTGATAGTGCTGG + Exonic
1106779428 13:33042682-33042704 GCATTTTTTTTTAATTGTGATGG + Intronic
1106812328 13:33371420-33371442 GCATTGTTTTTTCATGGTGAAGG + Intergenic
1106868671 13:33995419-33995441 AAATGTTCTTCTCATTGTGATGG + Intergenic
1109109830 13:58302648-58302670 CCATGTTCTTTTTATGATGATGG + Intergenic
1109550949 13:63899371-63899393 TCATGTTCTTTCCATATTGTAGG - Intergenic
1109773837 13:67013818-67013840 GTCTGTTTTTTTCATAGTTAAGG - Intronic
1110809811 13:79799624-79799646 GAATGTTTATTTCAGAGTGAAGG - Intergenic
1110893461 13:80718876-80718898 CCATTTTTTTTTCAAAGTGATGG - Intergenic
1111014487 13:82360467-82360489 ACATATCCTTTTCTTAGTGATGG + Intergenic
1112516419 13:100056954-100056976 GCATGTTCTTCTCATGGCAATGG - Intergenic
1113057965 13:106289979-106290001 GCATTTTCCATTCAGAGTGAAGG + Intergenic
1115242819 14:31266304-31266326 GCATTTTCTTTTTCTAGAGACGG - Intergenic
1116846831 14:49872430-49872452 GCATTTTTTTTTTATAGAGATGG + Intergenic
1120989490 14:90362706-90362728 GCATGTTCTGTGTCTAGTGAGGG + Intergenic
1121684942 14:95828940-95828962 GCATGTCCTTTTTATAGGGATGG + Intergenic
1122341168 14:101029424-101029446 GCAACCTCTTTTCATTGTGAAGG + Intergenic
1122415549 14:101547982-101548004 GCATGTTCTTTTCCCTGAGAGGG - Intergenic
1122648181 14:103208911-103208933 GAATGTTATTTATATAGTGATGG + Intergenic
1202885344 14_KI270722v1_random:101016-101038 TCATGTTTTTTACATATTGAAGG - Intergenic
1124825654 15:33092536-33092558 CCATGTTCGTCTCATGGTGAGGG - Intronic
1126838084 15:52687964-52687986 GCATCTGCTTTTCATGGTAATGG - Intronic
1130055175 15:80517395-80517417 GCATGTTATATTCAAACTGAAGG - Intronic
1131721483 15:95173176-95173198 GCATGTTTTTTACAAACTGAAGG + Intergenic
1133136093 16:3713152-3713174 GGCTGTTCTTTTCAGAGTGGAGG - Intronic
1134505176 16:14799675-14799697 TCATGTTTTTCTCATAGAGAAGG - Intronic
1134562740 16:15224732-15224754 GCATGCTCTTCTCATGGTGATGG - Intergenic
1134575400 16:15329235-15329257 TCATGTTTTTCTCATAGAGAAGG + Intergenic
1134727045 16:16427257-16427279 TCATGTTTTTCTCATAGAGAAGG - Intergenic
1134923278 16:18136365-18136387 GCATGCTCTTCTCATGGTGATGG - Intergenic
1134940392 16:18284598-18284620 TCATGTTTTTCTCATAGAGAAGG + Intergenic
1135519622 16:23164898-23164920 GCATGTGGTTTTCATGGTCAAGG - Intergenic
1135938924 16:26804032-26804054 TCCTGTTCTTTCCATAGTGAGGG + Intergenic
1136558109 16:31020718-31020740 GCAGATTCTGTTCACAGTGAGGG - Intergenic
1137465641 16:48706424-48706446 GAATGTACTTCTCATGGTGATGG + Intergenic
1137832067 16:51553471-51553493 GCATGTCTTTCTCATAGTCATGG - Intergenic
1138008397 16:53357497-53357519 GCCTGCTCATTTCATAGAGAGGG - Intergenic
1138067398 16:53956526-53956548 TCATGATCTTTTCATCCTGATGG - Intronic
1140241911 16:73209958-73209980 GCATGCTCATTTCTTAGAGAAGG - Intergenic
1140643608 16:77005526-77005548 GTATGTTCTTTTCATTGTACAGG - Intergenic
1141007378 16:80364906-80364928 GCATGTCCCTCTCATGGTGACGG - Intergenic
1141123744 16:81385130-81385152 GCTTGTGCTTTTCAGAGTAAAGG + Exonic
1144142679 17:12364805-12364827 GAAAGTTCTTTTCATAGCAATGG + Intergenic
1146632060 17:34477350-34477372 GGATGTTCTTCTCATGGAGAAGG - Intergenic
1149224634 17:54454862-54454884 GCTTTCTCTTTTCACAGTGATGG + Intergenic
1149548772 17:57524137-57524159 GCATGCCCTTGTCATGGTGATGG + Intronic
1150062077 17:62077105-62077127 GTATTTTTTTTTCATAGAGAGGG + Intergenic
1150418847 17:65011281-65011303 GCATGTAATTTGCATAGAGAAGG - Exonic
1151622066 17:75252231-75252253 GCTTGTTCTTTTTTTAGAGATGG + Intronic
1157510908 18:48273330-48273352 ACATGTTATTATCATAGAGATGG + Intronic
1158244801 18:55420078-55420100 GCATTTTCTTTTTAAAGTGATGG - Intronic
1159327854 18:66947512-66947534 CCATGTCCTTTTCATAGACATGG + Intergenic
1159684475 18:71401192-71401214 GGAAGTTCTGTTCATACTGAGGG + Intergenic
1163117730 19:15198341-15198363 GCATGCTCTTGTCAGAGAGAGGG + Intronic
1163275535 19:16281687-16281709 TCTTTTTCTTTTCATAGAGATGG - Intergenic
1164102851 19:22074142-22074164 GCAAGTTTTTTTCACAGTAACGG - Intronic
1164810763 19:31154095-31154117 GCATGTTCTTTTCATGGTGATGG - Intergenic
1164863097 19:31578595-31578617 GCATGGCCTTCTCATAGTCATGG + Intergenic
1165126683 19:33602982-33603004 GGATGCTATTTACATAGTGAGGG + Intergenic
1165976988 19:39684837-39684859 GCATGTTTTTTTTGTAGAGATGG + Intergenic
1166609692 19:44179910-44179932 GTATTTTTTTTTAATAGTGATGG - Intergenic
1202660749 1_KI270708v1_random:68045-68067 TCATGTTTTTTACATATTGAAGG - Intergenic
925877190 2:8322131-8322153 GTATGTTGTATTCCTAGTGAAGG - Intergenic
926777881 2:16440033-16440055 GCCTGTTGTTCTCAGAGTGAGGG - Intergenic
926778267 2:16443670-16443692 GCCAGTTCGTTTCCTAGTGAAGG + Intergenic
927021971 2:19026604-19026626 ACATCTTCTTTTCATTGTTAAGG - Intergenic
930080694 2:47445940-47445962 GCATTTTATTTTCAAAGAGAAGG + Intronic
930952854 2:57164613-57164635 GGTTTTTCTTTTCATTGTGATGG - Intergenic
931046563 2:58360711-58360733 GCATGTTCTTCTTATGGTGATGG + Intergenic
932341046 2:70962846-70962868 GCATGTGCTGGTCATACTGACGG + Exonic
932895494 2:75635629-75635651 GTAAGTTCATTTCACAGTGAAGG - Intergenic
933073331 2:77890226-77890248 GCAAGTTTTGTTTATAGTGAGGG - Intergenic
935087023 2:99858099-99858121 GCATGTCCTTTTCATGATGATGG - Intronic
935376364 2:102402297-102402319 GCTTGTTCTTTTCTTAGTCCCGG + Intergenic
936408368 2:112229520-112229542 GCATGTTCTTCTCATGGTGTTGG - Intronic
937045872 2:118851289-118851311 GCATGTGTTTATCAGAGTGAAGG + Intergenic
937450359 2:121997335-121997357 GCATGTCCTTTCCATATTCATGG + Intergenic
937843176 2:126547527-126547549 GCAAGCTCTTCTCATGGTGACGG - Intergenic
938748471 2:134304671-134304693 GCATGTTCTTTTCTACATGAAGG + Intronic
938977140 2:136490677-136490699 GCATGTTCAATTAATTGTGAAGG - Intergenic
939500954 2:142983271-142983293 GCAAGTCCTTCTCATAGAGATGG + Intronic
939627650 2:144497565-144497587 GCATTTTCTTTTTCTACTGAGGG - Intronic
939857890 2:147382536-147382558 GCATGCTTTTCTCATGGTGACGG + Intergenic
940437287 2:153669749-153669771 GGATTTCCTTTTCATAGTCAAGG + Intergenic
940524898 2:154800908-154800930 GCTTGTTCTTTTGATGGCGATGG - Intronic
941236355 2:162979782-162979804 GCATGTCCTTATCATGGAGATGG - Intergenic
941269189 2:163403931-163403953 GCATTTGCTTTTCATAGCCAAGG + Intergenic
941468623 2:165858657-165858679 GGCTGTTCTTGTGATAGTGAGGG - Intronic
941578417 2:167265204-167265226 GCATGCTCTTTTCATGGCAATGG + Intergenic
942298605 2:174540606-174540628 GCATTTTCTTATAATAATGATGG + Intergenic
944258050 2:197645050-197645072 GCATTTTCTCTTTACAGTGATGG - Intronic
944302470 2:198139233-198139255 GCTTTTTCTTTCCACAGTGAGGG + Intronic
945213380 2:207407504-207407526 GAATGTTCTTTGCATACTGCAGG - Intergenic
945797461 2:214382775-214382797 GCTTTTTCTTTTGAGAGTGATGG + Intronic
946071503 2:217038102-217038124 GCTTGGTCTATTCAGAGTGAAGG - Intergenic
946500206 2:220239101-220239123 TAATTTTCTCTTCATAGTGAAGG - Intergenic
947993480 2:234506293-234506315 GCATTTTTTTTTAATAGAGATGG - Intergenic
948015101 2:234682655-234682677 GCATGTTCTTTTCATAGTGAAGG + Intergenic
948872487 2:240810486-240810508 CCATGTTATTTTCAAAGTGGTGG - Intronic
1169846312 20:9995981-9996003 GCATGATCTTCTCTTTGTGATGG + Intronic
1170983208 20:21235214-21235236 ACATGCTCATTTCATTGTGATGG + Intronic
1171818565 20:29811345-29811367 GCCTGTTATTTTGATAGAGATGG + Intergenic
1171899240 20:30841670-30841692 GCCTGTTATTTTGATAGAGATGG - Intergenic
1171949411 20:31407489-31407511 GCATGTTCTTCTCATAGTGATGG - Intronic
1172398621 20:34629421-34629443 GTATTTTCTTTTCATAGCAATGG - Intronic
1172642632 20:36449983-36450005 GCATGTTCTCCTTATGGTGATGG + Intronic
1173317479 20:41958119-41958141 GCATGTCCTTTTCATGATGAAGG - Intergenic
1173358674 20:42319791-42319813 GCATGTTCTTTTCAGCTTGCTGG + Intronic
1173628352 20:44490623-44490645 CAATTTTCTTTTTATAGTGATGG + Exonic
1177300624 21:19240549-19240571 GCAGTTTTTTTTTATAGTGAAGG - Intergenic
1177568077 21:22848933-22848955 GCATATTCTTATTTTAGTGATGG - Intergenic
1177602909 21:23338248-23338270 GCATTTTTTTTTAATAGAGACGG - Intergenic
1177955068 21:27588059-27588081 CCATTTTCTTTTCCTAGTCAAGG - Intergenic
1180322009 22:11330729-11330751 GCCTGTTATTTTGATAGAGATGG + Intergenic
1180332908 22:11548974-11548996 GCCTGTTATTTTGATAGAGATGG - Intergenic
1181825342 22:25510746-25510768 GCATGTTCTTTTTGTGATGATGG + Intergenic
1181966881 22:26662827-26662849 GCATGTACTGTTCTTAGTAATGG - Intergenic
1183945353 22:41322800-41322822 GCCTTTTCTTTTCTTTGTGATGG + Intronic
949741576 3:7240290-7240312 GCATGGACTTGTGATAGTGAGGG + Intronic
951897611 3:27625289-27625311 CCATGTCCATTTCATAGAGAAGG + Intergenic
952833373 3:37584229-37584251 GCAGGTTCTTCTCATGGTGATGG + Intronic
955220076 3:57016068-57016090 GCATGTTCTTTTCCTTGTGTGGG - Intronic
955483245 3:59410635-59410657 GCATGTTCTTCTCAAGGTGATGG + Intergenic
955509958 3:59669590-59669612 GCACGTTTTTCTCAAAGTGATGG + Intergenic
955777126 3:62445871-62445893 GCATGTTGTTTTGATTCTGATGG - Intronic
955782255 3:62497495-62497517 GGATGTTCTTTTCAGATTGCAGG - Intronic
956479957 3:69663384-69663406 GCTTTTTCTTATCAGAGTGATGG - Intergenic
957087934 3:75700092-75700114 GCCTGTTATTTTGATAGAGATGG - Intergenic
957093543 3:75756006-75756028 CCATGTTTTTTACATATTGAAGG + Intronic
958700052 3:97577382-97577404 AAATTTTCTTTTAATAGTGAAGG + Intronic
959864306 3:111248609-111248631 GCATGTTCTTCTCATGGAAATGG + Intronic
960554199 3:119009431-119009453 CCATGCTGTTCTCATAGTGAGGG + Intronic
960610870 3:119553775-119553797 GAATGTTTATTTCATAGTCAGGG - Intronic
961315760 3:126034473-126034495 TCATTTTCTTTTCACAGAGAAGG + Intronic
961499875 3:127324546-127324568 GCAAGTTATGGTCATAGTGAAGG - Intergenic
961975180 3:131016829-131016851 TCATTTTCTTTTCATAGTAGAGG + Intronic
962216875 3:133530180-133530202 CCATATTCTTCTCATGGTGATGG + Intergenic
962359228 3:134723362-134723384 GTATGTTCTTCTCAGGGTGATGG - Intronic
964049138 3:152370077-152370099 TCTTGTTCTTTTCATTGTGATGG + Intronic
965113394 3:164456319-164456341 GCTTGTTTTTTTCATATTGCTGG - Intergenic
965698431 3:171434877-171434899 GCATGTTCTTTTTAAAGTGAGGG - Intronic
965846391 3:172967481-172967503 ATATGTTATTTTCATAGTGATGG + Intronic
966205066 3:177397789-177397811 GCATTTTTTTATAATAGTGAAGG - Intergenic
967366043 3:188687438-188687460 TGCTGTTCTCTTCATAGTGAGGG + Intronic
967514421 3:190349754-190349776 GCATGTTCTTCTCATGGTAATGG - Intronic
967820307 3:193833773-193833795 GCATGGTCATGTCATAGTGAAGG + Intergenic
969361905 4:6669811-6669833 GCCCGTTCTTCTCATAGCGAAGG + Intergenic
970655111 4:18222381-18222403 TCTTGTTCTTTTAATTGTGATGG + Intergenic
971813268 4:31455569-31455591 GTATGATCCTGTCATAGTGAAGG + Intergenic
971984476 4:33804130-33804152 GCATGTACTTTTCATTGCTAAGG + Intergenic
972029603 4:34437201-34437223 AAATGTTCTTTTCATTATGAGGG + Intergenic
973325351 4:48855003-48855025 TCATGTTCTCTCCATAGTGTGGG + Intronic
973833429 4:54785033-54785055 TCATGTTCTTCTCATAGTTAGGG - Intergenic
974008641 4:56586279-56586301 GCATATTCTTTTCTTGGTGAGGG + Intronic
974117355 4:57596237-57596259 GCAGGTTCATTTCTCAGTGACGG + Intergenic
976080938 4:81354013-81354035 GCATATTCTGTTCCTGGTGAGGG + Intergenic
976381193 4:84401013-84401035 TCTTGTTTTTTTCACAGTGAAGG - Intergenic
976471638 4:85435982-85436004 GCAATTTATTTTCAAAGTGAAGG - Intergenic
977508014 4:97926476-97926498 GCATGTTCTTCTAATGGTGATGG - Intronic
978047681 4:104152198-104152220 ACATGTATTTTTCATAATGAAGG + Intergenic
980169607 4:129273342-129273364 GCATGTTCTTTGCATGTTCATGG + Intergenic
980886203 4:138765540-138765562 GTAGGTTATTATCATAGTGAAGG - Intergenic
981989735 4:150903332-150903354 ACATGTTCTTTTCATGGCCATGG - Intronic
983731188 4:170995721-170995743 CCAAGTTCTTCTCACAGTGATGG - Intergenic
985196837 4:187439717-187439739 CCTTGTTCTTTTCATCGTAAAGG + Intergenic
985443055 4:189998727-189998749 GCCTGTTATTTTGATAGAGATGG + Intergenic
986633008 5:9792909-9792931 GCATATTCTCTTGAAAGTGAAGG + Intergenic
987234011 5:15924939-15924961 GCATGTTCTCCTCACTGTGAAGG + Intronic
987524904 5:19034882-19034904 GCATGTTTTTTTAGTAGAGATGG + Intergenic
987546031 5:19311052-19311074 TGATGTTCTTCTGATAGTGAGGG - Intergenic
988152363 5:27400883-27400905 GCATTTTCTTTTCAAATTAATGG + Intergenic
988842424 5:35096015-35096037 GCATGTGCTGTGCATGGTGATGG + Intronic
988926304 5:35994138-35994160 ACCTGTTCTTTACCTAGTGATGG - Intergenic
989184962 5:38614782-38614804 GCATGCTGTTTCCATACTGATGG - Intergenic
994535401 5:101024426-101024448 GCATCTTCTTTACAAAGTGCAGG + Intergenic
994942267 5:106339884-106339906 GCATGTTCTACTCATGGTAATGG + Intergenic
994977760 5:106831871-106831893 GCATGTTCTTCTCATGATAATGG - Intergenic
995499011 5:112782482-112782504 ACATGTTAGTTTCATAGTGAAGG + Intronic
996252133 5:121348321-121348343 GCCTTTGATTTTCATAGTGATGG + Intergenic
996340724 5:122436032-122436054 GCATGTCCTTTACAGAGTCAGGG + Intronic
996915338 5:128705308-128705330 AAATGCTCTTTTCATTGTGATGG + Intronic
998435809 5:142108265-142108287 TCATGTACTTTTCACAGTCATGG + Intergenic
999344438 5:150803581-150803603 ATATGTTCTTTTTATAGAGATGG + Intergenic
1000128914 5:158275727-158275749 GCATGTTCTTCTCCTACTGATGG - Intergenic
1000497594 5:162004105-162004127 GAATTTTCTTTTCACAGTTATGG - Intergenic
1000831578 5:166108539-166108561 GCATGTTGTGTTCATAGACATGG + Intergenic
1000890950 5:166801324-166801346 GCATGCTATTCTCATGGTGATGG + Intergenic
1002154275 5:177263633-177263655 GCAGTTTCTTTGCATACTGATGG + Intronic
1004013124 6:11708424-11708446 GCATGTTCAATTCTCAGTGAAGG - Intergenic
1004260767 6:14105676-14105698 ACATGTTCTTCTCATGATGATGG + Intergenic
1004483838 6:16047066-16047088 TGATGTTCTTGTCATAGTGAGGG - Intergenic
1005195609 6:23280127-23280149 GCATGTTCTTTACATATTGAGGG + Intergenic
1005424956 6:25692863-25692885 ATCAGTTCTTTTCATAGTGAGGG - Intronic
1006014860 6:31072408-31072430 GCCTGTATTTTGCATAGTGAAGG + Intergenic
1006870436 6:37246371-37246393 GCATGCTCTTCTCATAGTGCAGG + Intronic
1007033755 6:38653607-38653629 GCATGGTTTTCTCATGGTGACGG + Intergenic
1009197341 6:60702805-60702827 TCATGTTCTTCTCATGGTGATGG + Intergenic
1009601096 6:65800918-65800940 ACATGATCTTCTCATGGTGATGG - Intergenic
1010908570 6:81523604-81523626 GCATGTACTTTTCATAGAATGGG - Intronic
1011675687 6:89731445-89731467 GCATGTTCTTTGCAGGGTCATGG + Intronic
1013118839 6:107123674-107123696 GCATGGTCTCTTTCTAGTGAGGG + Intergenic
1013141691 6:107342652-107342674 TTATCTTCTTTTCAGAGTGAGGG - Intronic
1014487424 6:122016711-122016733 CCATGCTCTCATCATAGTGAGGG - Intergenic
1014959535 6:127666018-127666040 CCATGTTCTTTCTATAGTAAAGG - Intergenic
1016736949 6:147489612-147489634 GCATATTCTTCACATAGTCATGG + Intergenic
1018098782 6:160417813-160417835 GAATTTTCTCTTCATGGTGATGG - Intronic
1018413604 6:163581822-163581844 GTATGTTCATTTCAGAATGATGG + Intergenic
1019950412 7:4367739-4367761 GCGTGTTCTTCTCATGGTGGTGG - Intergenic
1020250103 7:6460640-6460662 GCATGTGCTTTTCTTACTTAAGG + Intronic
1021059059 7:16086913-16086935 GCATGTTCTTCTCATGGTGGTGG + Intergenic
1021294935 7:18893150-18893172 TAACGTTCTTTTCATATTGATGG + Intronic
1022404477 7:30074764-30074786 GCCAGTTATTTTCATTGTGAAGG + Intronic
1023916315 7:44591969-44591991 GCATCTGCTTTTCAAATTGATGG - Intergenic
1023975600 7:45027636-45027658 TCATGTTTTTTTCAGAGGGAGGG + Exonic
1025271333 7:57521361-57521383 AAATGTTCTTTTCATTATGAGGG - Intergenic
1026240078 7:68566043-68566065 TCATGTTCTTCTCATTATGAAGG + Intergenic
1027483872 7:78734690-78734712 GCATGTTCTTCTCATGGCAATGG - Intronic
1027537413 7:79421712-79421734 GGATATTCTTTTCAGAGTAATGG - Intronic
1028085464 7:86631499-86631521 GCATATTCTGTTCATAATAAGGG + Intergenic
1028728508 7:94117353-94117375 GCATGTTCTCTTCATGGCAATGG + Intergenic
1029291642 7:99506110-99506132 GGAAGACCTTTTCATAGTGAAGG + Exonic
1029910585 7:104142819-104142841 GTCTCTTCTTTTCATAGTAAAGG - Intronic
1031639514 7:124144406-124144428 GCATGTTCTTCTAATGGTGATGG + Intergenic
1033811014 7:145011246-145011268 GCCTGTTTTTTTCAAAGTAAAGG - Intergenic
1034450637 7:151135410-151135432 GCCTGTGCTTGTCACAGTGAGGG + Intronic
1038210738 8:25517183-25517205 ACATGTTCTTTTCATATTTGGGG + Intergenic
1038358704 8:26856073-26856095 GCACGTTCTTTTGAAAATGATGG + Intronic
1038713579 8:29971915-29971937 GCACGTTCTTCTCATGATGAAGG - Intergenic
1038813528 8:30877109-30877131 AAGTGTTCTTTTCCTAGTGATGG - Intronic
1039736771 8:40340893-40340915 ACTTATTCTTCTCATAGTGAGGG - Intergenic
1040615918 8:49038298-49038320 GAATGTTCTTTTCTTTGTGAAGG + Intergenic
1040688194 8:49902099-49902121 TCATGACCTTTTCATCGTGATGG + Intergenic
1040764771 8:50894010-50894032 GCATGTCCTTTTCAGATTAAAGG + Intergenic
1041361640 8:57060947-57060969 GAATGTCTTTTTCATAGTGAAGG - Intergenic
1042470449 8:69181632-69181654 TCATTTTCTTTTCATTTTGATGG + Intergenic
1042781001 8:72491073-72491095 GCATGTTCTTCTCATGGCAATGG - Intergenic
1044350849 8:91164895-91164917 GCATGTTCTTTTAATTGTTGAGG + Intronic
1045860497 8:106810987-106811009 GCATGTCCCTTCCATACTGAAGG - Intergenic
1046179697 8:110628696-110628718 ACCTGTTATATTCATAGTGAGGG + Intergenic
1047042950 8:121018790-121018812 TTATGTTCTTTTCATATTGATGG + Intergenic
1047419843 8:124698332-124698354 GCCTGTTCTTTTCATTGTCGTGG - Intronic
1048226696 8:132594625-132594647 TGCTGTTCTCTTCATAGTGAGGG + Intronic
1048338903 8:133523936-133523958 GCATGTTTTTCTCATAATGGAGG - Intronic
1048386610 8:133918134-133918156 GCATGTCCCTTGAATAGTGAGGG + Intergenic
1050886850 9:10777582-10777604 CCATGTTGTTTTAATAGAGATGG + Intergenic
1052610721 9:30770036-30770058 GCATTTTCTGTTCATAGAAAAGG - Intergenic
1053346462 9:37382161-37382183 ACAGGTTCTTCTCATGGTGATGG - Intergenic
1055596167 9:77866569-77866591 GCATGTACTAATCATACTGATGG + Intronic
1056048303 9:82741902-82741924 GCGTGTTCTCTTCATGATGATGG + Intergenic
1056227738 9:84512732-84512754 GCATGTTCTTCTCATGGCAATGG + Intergenic
1057667149 9:97055039-97055061 CCATTTTCTTTTCATGATGATGG - Intergenic
1059377026 9:113890189-113890211 ACATGTTATTTTTATAGTCAGGG - Intronic
1059730046 9:117048021-117048043 GCATGTTCTTTGGCAAGTGATGG - Intronic
1060753944 9:126196269-126196291 GTATGTTCTTCTCACAGCGATGG - Intergenic
1203370227 Un_KI270442v1:296616-296638 GCCTGTTATTTTGATAGAGATGG + Intergenic
1186668932 X:11749331-11749353 GCATCTTTTTTTCACAGTGTGGG - Intergenic
1187090284 X:16088974-16088996 GAATATTCTGTTCATAGTGTTGG - Intergenic
1187311783 X:18151500-18151522 CCTTGTTTTCTTCATAGTGAGGG - Intergenic
1187719450 X:22136055-22136077 GCATGTTCATTTAATTTTGAGGG - Intronic
1188087698 X:25921053-25921075 CCATTCTCTTCTCATAGTGATGG + Intergenic
1188376680 X:29439310-29439332 TCATGTTCTTTTCATGGGAAAGG + Intronic
1188481465 X:30640653-30640675 GTATGTTCTTCTCATGGTGATGG - Intergenic
1188544882 X:31293994-31294016 GTATTTTCTTTTCGTAGAGATGG - Intronic
1188575552 X:31645664-31645686 GCATGTTCTATGCATAGTATTGG + Intronic
1188729779 X:33631674-33631696 GCATGTGCTTATGTTAGTGATGG - Intergenic
1189180183 X:38996701-38996723 GCAAGTTCTGTTCTTGGTGAGGG + Intergenic
1189743799 X:44149262-44149284 CCATGTTCTTTTCATGGTGATGG - Intronic
1190204209 X:48389330-48389352 GCATGATCTTTACAATGTGAAGG - Exonic
1190206327 X:48406073-48406095 GCATGATCTTTACAATGTGAAGG + Exonic
1190631019 X:52386195-52386217 GCAGGTAGTTTTCAGAGTGACGG - Intergenic
1191929070 X:66349021-66349043 TCTAGTTCTTTTCATTGTGATGG - Intergenic
1192832979 X:74769478-74769500 GTAGTTTCTTTTCATAGTGTTGG - Intronic
1193419239 X:81263743-81263765 GCATTTTTTTTTTAAAGTGATGG + Intronic
1193434845 X:81460134-81460156 TCATGTTCTCATGATAGTGAGGG + Intergenic
1193706045 X:84821551-84821573 GCATGTTCTAATCATAGCAAAGG - Intergenic
1194056650 X:89143273-89143295 ACATATTCTTGTCATGGTGAAGG - Intergenic
1195112949 X:101665666-101665688 GCATTTTCTTTTTAGTGTGAGGG + Intergenic
1195476922 X:105297618-105297640 CCCTGTTCTTGTGATAGTGAAGG - Intronic
1196990139 X:121319859-121319881 CCATGTTCTTTTCCCAGTGGTGG - Intergenic
1198028755 X:132734783-132734805 GCATTTTCTTTTCCTAAAGATGG - Intronic
1199727520 X:150599304-150599326 CCATGTTATTGTCCTAGTGATGG - Intronic
1200914189 Y:8556892-8556914 GCATGTTTTTCTCATTGTGGAGG + Intergenic
1200939583 Y:8767750-8767772 GCATGGCCTTCTCATAGTGGAGG - Intergenic
1200963317 Y:9014451-9014473 GCATGTTCTTTTCATTGTGGAGG - Intergenic
1202023152 Y:20489342-20489364 TCATGTTCTTTTCAGAGACATGG + Intergenic
1202129725 Y:21598670-21598692 GCATGGCCTTTTCATTGTGGAGG - Intergenic
1202149782 Y:21834334-21834356 GCATGTTCTTTTCACTGTGGAGG + Intergenic