ID: 948015102

View in Genome Browser
Species Human (GRCh38)
Location 2:234682666-234682688
Sequence TCATAGTGAAGGCAGACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948015100_948015102 -3 Left 948015100 2:234682646-234682668 CCAGTTGGGGCATGTTCTTTTCA No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015099_948015102 6 Left 948015099 2:234682637-234682659 CCAGAGAGGCCAGTTGGGGCATG No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015094_948015102 16 Left 948015094 2:234682627-234682649 CCTCCTGGGACCAGAGAGGCCAG No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015093_948015102 17 Left 948015093 2:234682626-234682648 CCCTCCTGGGACCAGAGAGGCCA No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107
948015095_948015102 13 Left 948015095 2:234682630-234682652 CCTGGGACCAGAGAGGCCAGTTG No data
Right 948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948015102 Original CRISPR TCATAGTGAAGGCAGACCAC AGG Intergenic
906710945 1:47929652-47929674 GCAAAGTGAAGGCCGACCCCTGG - Intronic
909323081 1:74314808-74314830 TAATAGTGAAGAGACACCACAGG + Intronic
909443553 1:75724273-75724295 TAAAGGTGAAGGCTGACCACGGG + Intergenic
909960463 1:81834414-81834436 TCATATTGGAGCCAAACCACTGG - Intronic
910798996 1:91127264-91127286 TCAAAGTGATCTCAGACCACTGG - Intergenic
911730105 1:101283679-101283701 TGACAGGCAAGGCAGACCACAGG + Intergenic
914743395 1:150483673-150483695 AAATAGTGAAGGCATAGCACCGG + Intergenic
920114407 1:203609854-203609876 GCATAGTGCAGGCAGTCCATGGG + Intergenic
923150045 1:231224721-231224743 GCATTGTGAAGGAAAACCACAGG - Intronic
924849631 1:247812762-247812784 TCAAAGTGAAGTCAGAACAGTGG + Intergenic
1063259554 10:4370488-4370510 TCAAAGGGAAGGCAGGCAACTGG + Intergenic
1063308023 10:4924209-4924231 TAATAGTCAAGGCAGAACAAAGG - Intronic
1063402922 10:5765058-5765080 TCACAGGGAAGCCAGACGACAGG + Intergenic
1065867014 10:29923107-29923129 TCAAGGTGAAAGCAGACCCCAGG - Intergenic
1072301926 10:94070118-94070140 TCATAGTGACAGCTGACCATTGG - Intronic
1073689084 10:105787400-105787422 TCATAGGTAAGGCAGGTCACAGG + Intergenic
1075702900 10:124480812-124480834 ACATAGTGAATGCAGACCAGAGG - Intronic
1077508666 11:2943861-2943883 CCAGAGAGAAGGCAGCCCACGGG + Intergenic
1086827783 11:91520325-91520347 TCATAGAGATGGCAGAGGACAGG - Intergenic
1087085929 11:94218994-94219016 TCATATAGAAGTCAGACCATAGG + Intergenic
1090074621 11:123572584-123572606 TCAGAGTGGAGGTAGAGCACCGG + Intronic
1090265119 11:125348784-125348806 TCATAATGAAGGCAAAACAAAGG - Intronic
1091457713 12:620122-620144 TCCTAGTGACGGGAGAGCACAGG + Intronic
1096599466 12:52719047-52719069 ACTGAGAGAAGGCAGACCACAGG - Intergenic
1098422914 12:70322751-70322773 TCATAGAGAACCCAGAGCACAGG + Intronic
1099174543 12:79405721-79405743 TCATAGAGTAGGCAAACCAAAGG - Intronic
1100025523 12:90122805-90122827 ACAGTGGGAAGGCAGACCACTGG + Intergenic
1100991786 12:100259223-100259245 TCATGGTAAAGGCAGACACCAGG + Intronic
1101042348 12:100769404-100769426 TTATAGTGTAGGCATCCCACTGG + Intronic
1103834362 12:123807325-123807347 TCATAGAGAAGGCAGGACACAGG + Intronic
1112311190 13:98318711-98318733 TCAAAGAGAAGGCAGACTGCTGG - Intronic
1118326502 14:64785069-64785091 TCCTAGTTAAAGCAGACCCCTGG - Intronic
1118438366 14:65791367-65791389 TCATAGTGAAGGCAGTAGATGGG + Intergenic
1119436979 14:74603990-74604012 ACATAAAGAAGGCAGTCCACTGG + Intronic
1119559012 14:75575388-75575410 TGATAGTTAAGTCAGCCCACTGG - Intergenic
1121272311 14:92646180-92646202 GCATAGCGCAGGCAGAGCACGGG - Intronic
1123989525 15:25673133-25673155 TCATCCTGACGGCTGACCACTGG - Intergenic
1124654856 15:31499756-31499778 TCACAGTCAAAGCAGCCCACTGG - Intronic
1127651769 15:61015902-61015924 TCATACTGAAAACAGACCCCTGG - Intronic
1133607840 16:7405693-7405715 TAACAGGGAAGGCTGACCACAGG - Intronic
1145857644 17:28177565-28177587 TGAAAATGAAGGCAGAACACAGG - Intronic
1147747350 17:42702936-42702958 TCATGGTGAATGGAGACCATCGG - Exonic
1149251997 17:54780726-54780748 ACAGAGGGAAGGCAGAGCACAGG + Intergenic
1153617558 18:6948466-6948488 TCACCGTGAAGGCAGACACCGGG + Exonic
1153648296 18:7214997-7215019 TCATAGGGAAGGTAGACGATAGG + Intergenic
1157666265 18:49489716-49489738 TAAAGGTGAAGGCAGACAACTGG - Intronic
1159148931 18:64494943-64494965 CCATAGTGAAAGCTGTCCACAGG + Intergenic
1162986249 19:14272048-14272070 TCAGAGTGTAGGCAGAGCAGGGG - Intergenic
1167461985 19:49630088-49630110 TCAAAATGAAGGAAGACAACCGG + Intergenic
927369870 2:22342076-22342098 TGATGGTGAAGGCAGATCTCAGG + Intergenic
928105741 2:28469535-28469557 TCATAGTGATGGCAGGGAACTGG + Intronic
928645692 2:33350310-33350332 TCATACTGAAGGCAGAACTAGGG + Intronic
930037594 2:47096948-47096970 TCACAGTGAGGGGAGGCCACGGG + Intronic
931102112 2:59013826-59013848 TCATAGTTAAGGTACACCATAGG - Intergenic
932045660 2:68346667-68346689 TCATATTGATGACAGCCCACAGG - Intergenic
938162625 2:128999735-128999757 TCAGAGGAAAGGAAGACCACAGG - Intergenic
939305272 2:140402436-140402458 TCACTGTGAAGGCAGTCTACAGG - Intronic
939356804 2:141113155-141113177 TTTAAGTGAAGGCAGAACACTGG + Intronic
939422626 2:141993316-141993338 TCATAGTGAATGAAGACTCCTGG - Intronic
945976443 2:216274713-216274735 TCATAGGAAAGGCTGTCCACAGG - Intronic
946201627 2:218073889-218073911 TCAGAGTGAAGGCAGGGCAGAGG - Exonic
947633029 2:231665993-231666015 TCAGAAGGAAGGCAGCCCACGGG + Intergenic
948015102 2:234682666-234682688 TCATAGTGAAGGCAGACCACAGG + Intergenic
1169237069 20:3938693-3938715 TGAAAGTGAAGGCAACCCACAGG - Intronic
1172021423 20:31917007-31917029 CCATAGGGAAGGCAGCCAACAGG + Intronic
1175418785 20:58818260-58818282 TCACAGTCAAGGAAAACCACTGG + Intergenic
1176003515 20:62846267-62846289 TCATAGTGAAGGCAGACGCCGGG - Intronic
1176955047 21:15092758-15092780 TCATGGAAAAGGCAGCCCACTGG - Intergenic
1178725648 21:35049181-35049203 TCACACTGAATGCAAACCACAGG - Exonic
1181733575 22:24865162-24865184 GCATAGTGAATGCTGAGCACTGG - Intronic
955989873 3:64615159-64615181 TCATGGTGCAGGCAGAGAACTGG + Intronic
957636402 3:82791078-82791100 TGATAGTGAAGGGAGAACTCAGG + Intergenic
960825861 3:121783729-121783751 TGATGGTGAATGGAGACCACAGG - Intronic
961058914 3:123812067-123812089 TCTTAGAGAAAGCAGACCCCTGG + Intronic
963750023 3:149167716-149167738 TTATAGTTAAGGCAGAAGACTGG + Intronic
964863758 3:161231053-161231075 GCATAGAGCAGGCAGAGCACTGG + Intronic
967420868 3:189271039-189271061 TCATAGTGAAGGCAGGAGAGTGG + Intronic
970321675 4:14880968-14880990 TCTGAGTGAAGGCTGACCTCTGG - Intergenic
976255401 4:83095209-83095231 TCATGGTGAAGGCAGATCCCAGG + Intronic
976256423 4:83105342-83105364 TAGTAGTGAAGGCAGATCATAGG + Intronic
981925101 4:150130693-150130715 TAAAAGAGAAGGAAGACCACCGG + Intronic
982234778 4:153242342-153242364 TCACAGAGAAGGCAGACTCCTGG - Intronic
988589294 5:32535010-32535032 TCAGCGTGCAGGCAGAGCACAGG - Intronic
993532019 5:89036778-89036800 TCATTGTGAATGCAGGCAACAGG + Intergenic
995466223 5:112451516-112451538 ATGTAGTGATGGCAGACCACTGG + Intergenic
996672988 5:126141018-126141040 TCATACTCAAGGCACAGCACAGG - Intergenic
998395295 5:141814319-141814341 TCAGAGGGAAGGAAGCCCACTGG - Intergenic
1009497947 6:64374118-64374140 TCAGGGTGAAGGGAGACCACTGG + Intronic
1010358987 6:74970418-74970440 TCATAGAAGAGGCAGATCACAGG - Intergenic
1012190631 6:96275989-96276011 TCATAGAGTATGCAGTCCACTGG + Intergenic
1012436809 6:99223682-99223704 TCAGAGTAAAGGCAGCCCAGAGG + Intergenic
1014997812 6:128173513-128173535 TCATAGAGAGGGCAGACAGCAGG - Intronic
1018731034 6:166650590-166650612 CCCTAGTGAAGGCAGGACACAGG - Intronic
1019057648 6:169234860-169234882 TGACAGTGCAGGCCGACCACGGG + Exonic
1021619264 7:22535254-22535276 TCATACTGAATTCAGACCTCGGG - Intronic
1023854132 7:44171026-44171048 TCATACTTAAGGCACACCAAGGG + Intronic
1024282803 7:47733364-47733386 TCATAGGGAAAGCAGACACCAGG + Intronic
1026553980 7:71390382-71390404 TCCCAGAGAAGGCAAACCACTGG - Intronic
1027184316 7:75961373-75961395 TCAGAGTGAATGCAGCGCACAGG - Intronic
1028371997 7:90102336-90102358 TCATACTGAATTCAGACCTCGGG + Intergenic
1038903598 8:31872030-31872052 TCAAAGTCAAGGGAGACCAAGGG - Intronic
1038991139 8:32869688-32869710 TCATAGAGGAAGGAGACCACAGG - Intergenic
1039383692 8:37111059-37111081 TCATAGTCAAGGCCCTCCACTGG - Intergenic
1041511725 8:58660276-58660298 TCCCAGTGAAGGCAGGCCAGGGG + Intergenic
1044806412 8:96012822-96012844 TCATAGAGAAGTCATCCCACTGG + Intergenic
1045664238 8:104468313-104468335 TCAGAGAGAAGGGAGACCACAGG + Intergenic
1045815064 8:106269901-106269923 TCCTAGTGCAGGCAGACGCCTGG + Intergenic
1048197020 8:132339732-132339754 TCATAGTGATGGCAAAGCACTGG - Intronic
1051843066 9:21420233-21420255 AGAGAGTGAAGGCAGGCCACTGG - Intronic
1052729752 9:32271452-32271474 TCATACTGAAAGTACACCACTGG - Intergenic
1056817818 9:89814492-89814514 TCAGAGGGAAGGCAGAGAACAGG + Intergenic
1056873791 9:90308436-90308458 TGATATTGAAGACAGACCAATGG + Intergenic
1058260658 9:102826263-102826285 TCATAGTTAACACAGACCATAGG + Intergenic
1059798951 9:117730396-117730418 AGATAGTGGAGGCAGACCACTGG + Intergenic
1060505919 9:124198460-124198482 TCTTACTGGAGGCTGACCACTGG + Intergenic
1062156278 9:135050470-135050492 TCACTGTGAAGGCAGAGCAGGGG - Intergenic